Ontology highlight
ABSTRACT:
PROVIDER: PRJNA817042 | ENA |
REPOSITORIES: ENA
Dataset's files
| Action | DRS | |||
|---|---|---|---|---|
| SRR18344245_1.fastq.gz | Fastqsanger.gz | |||
| SRR18344245_2.fastq.gz | Fastqsanger.gz | |||
| SRR18344246_1.fastq.gz | Fastqsanger.gz | |||
| SRR18344246_2.fastq.gz | Fastqsanger.gz | |||
| SRR18344247_1.fastq.gz | Fastqsanger.gz |
Items per page: 5 1 - 5 of 26 |
Similar Datasets
Project description:Genome graphs, including the recently released draft human pangenome graph, can represent the breadth of genetic diversity and thus transcend the limits of traditional linear reference genomes. However, there are no genome-graph-compatible tools for analyzing whole genome bisulfite sequencing (WGBS) data. To close this gap, we introduce methylGrapher, a tool tailored for accurate DNA methylation analysis by mapping WGBS data to a genome graph. Notably, methylGrapher can reconstruct methylation patterns along haplotype paths precisely and efficiently. To demonstrate the utility of methylGrapher, we analyzed the WGBS data derived from five individuals whose genomes were included in the first Human Pangenome draft as well as WGBS data from ENCODE (EN-TEx). Along with standard performance benchmarking, we show that methylGrapher fully recapitulates DNA methylation patterns defined by classic linear genome analysis approaches. Importantly, methylGrapher captures a substantial number of CpG sites that are missed by linear methods, and improves overall genome coverage while reducing alignment reference bias. Thus, methylGrapher is a first step towards unlocking the full potential of Human Pangenome graphs in genomic DNA methylation analysis.
2025-02-01 | GSE261315 | GEO
Project description:Design and Validation of Dolosigranulum pigrum specific PCR primers using the core genome
| PRJNA770953 | ENA
Project description:The water vole Arvicola terrestris (= Arvicola amphibious L.) is endemic in Europe where its outbreak generates severe economic losses for farmers. Our project aimed at deciphering the modalities of chemical communication in this species, to develop new sustainable methods for populations control. The water vole, as well as other rodents, uses specific urination sites as territorial and sex pheromone markers, the chemical and biochemical identification of which is still unknown. Lateral scent glands and urine samples were collected from wild males and females caught in the field, at different periods of the year. Volatile signals were searched in urine by SPME/GC-MS, and in lateral scent glands by solvent extraction followed by GC-MS. The volatile composition of urine was analysed for each individual and not on pooled samples, showing no significant difference between males and females. Lateral scent glands contained some volatile components (pyrazines, alcohols, terpenes), and mostly long chain fatty acid esters, again without quantitative and qualitative differences between sexes. Conversely, the urinary protein content, analysed by 1D- and 2D-electrophoresis is different, as only males secrete high levels of lipocalins, whatever the reproduction period. The proteins were identified by mass spectrometry and “de novo” analysis (Orbitrap), which provided specific information to design primers for PCR amplification of cDNA sequences. Thus, urinary proteins were characterized by direct amplification from liver RNA. The identified protein sequences are closed to those of Myodes glareolus, a closely related species of Cricetidae, and to hamster Aphrodisin.
2019-12-11 | PXD013803 | Pride
Project description:Design and comparison of short phytoplankton primers for sedaDNA
| PRJEB73990 | ENA
Project description:Pangenome arrays contain DNA oligomers targeting several sequenced reference genomes from the same species. In microbiology these can be employed to investigate the often high genetic variability within a species by comparative genome hybridization (CGH). The biological interpretation of pangenome CGH data depends on the ability to compare strains at a functional level, particularly by comparing the presence or absence of orthologous genes. Due to the high genetic variability, available genotype-calling algorithms can not be applied to pangenome CGH data. Therefore, we have developed the algorithm PanCGH that incorporates orthology information about genes to predict the presence or absence of orthologous genes in a query organism using CGH arrays that target the genomes of sequenced representatives of a group of microorganisms. PanCGH was tested and applied in the analysis of genetic diversity among 39 Lactococcus lactis strains from three different subspecies (lactis, cremoris, hordniae) and isolated from two different niches (dairy and plant). Clustering of these strains using the presence/absence data of gene orthologs revealed a clear separation between different subspecies and reflected the niche of the strains. Keywords: CGH, CGH analysis, orthology, Lactococcus lactis
2008-12-31 | GSE12638 | GEO
Project description:Highly-automated, high-throughput replication of yeast-based logic circuit design assessments
| PRJNA784977 | ENA
Project description:Diagnostic primer extension assay to serotype Streptococcus pneumoniae. Assay validation. Background: Monitoring of Streptococcus pneumoniae serotype epidemiology is essential since serotype replacement is a concern when introducing new polysaccharide-conjugate vaccines. To simplify S. pneumoniae serotyping, a novel PCR-based automated microarray assay was developed to assist in the tracking of the serotypes. Results: Autolysin (lytA), pneumolysin (ply) and eight genes located in the capsular operon (cps) were amplified using multiplex PCR. This step was followed by a tagged fluorescent primer extension step targeting serotype-specific polymorphisms. The tagged primers were then hybridized to a microarray. Results were exported to an expert system that transforms genetic typing data into capsular serotype identification. The assay was validated on 166 cultured S. pneumoniae samples from 63 different serotypes as determined by the Quellung method. In addition, the assay was tested on clinical specimens including 43 cerebrospinal fluid samples from patients with meningitidis and 59 nasopharyngeal aspirates from bacterial pneumonia patients. The assay presented with no cross-reactivity for 24 relevant bacterial species found in these types of samples. The limit of detection for serotyping and S. pneumoniae detection was 100 genome equivalent per reaction. Conclusion: This automated assay is amenable to clinical testing and does not require any culturing of the samples. The assay will be useful for the evaluation of serotype prevalence changes after new conjugate vaccines introduction.
2013-12-31 | GSE45865 | GEO
Project description:Usually, unmapped reads have been considered as useless and been trashed or ignored. Here, we develop a strategy to mining the full length sequence by unmapped reads combining with specific reverse transcription primers design and high throughput sequencing. In this study, we salvage 36 unmapped reads from standard RNA-Seq data(GSM3188619) and randomly select one 149 bp read as a model(CTGGTGCCATAATTCAGGGAACTGTGTTCTTGATGTACTATCTGAGACATTTGTGCTTCCCCCCATCCAGCTATCAGGCTGTTAGGCAATGCACTTCTAGGAATTAGAATTCTATAAGGAATCTCATGCTGGAAGAACAAAAAGACCCA ). Specific reverse transcription primers(5' end:CTGGTGCCATAATTCAGGGA, 3' end:GGATCTTCACGTAACGGATTGT) are designed to amplify its both ends, followed by next generation sequencing. Then we use a statistical model base on power law distribution to estimate its integrality and significance. Further, we validate it by Sanger sequencing. The result shows that the full length is 1,556 bp, with InDel mutation in microsatellite structure. This would be a useful strategy to extract the sequences information from the unmapped RNA-seq data.
2021-04-22 | GSE172487 | GEO