Browse
Submit Data
Databases
API
Help

Dataset Information

0 Views

0 Connections

0 Citations

0 Reanalyses

0 Downloads

Omics score: 0

ABSTRACT: 16S amplicon of the cecum capacity of mice

PROVIDER: PRJNA831647 | ENA |

REPOSITORIES: ENA

ACCESS DATA

Json Xml

Dataset's files

Source:

			Action	DRS
	SRR18912500_1.fastq.gz	Fastqsanger.gz
	SRR18912500_2.fastq.gz	Fastqsanger.gz
	SRR18912501_1.fastq.gz	Fastqsanger.gz
	SRR18912501_2.fastq.gz	Fastqsanger.gz
	SRR18912502_1.fastq.gz	Fastqsanger.gz

Items per page:

1 - 5 of 116

Similar Datasets

Project description:16S amplicon of chicken cecum contents

| PRJNA647992 | ENA

Raw potato starch alters the cecal microbiome and gene expression in mice fed a Western diet (Distal Colon)

Project description:We investigated the effect of feeding mice a Total Western Diet formulated using the 50th percentile daily intake levels for macro and micronutrients from the National Health and Nutrition Examination Survey (NHANES) with 0, 2, 5, or 10% added raw potato starch on the cecal microbiome (16S) and cecum, proximal and distal colon gene expression by RNASeq analysis.

2022-04-13 | GSE182457 | GEO

Raw potato starch alters the cecal microbiome and gene expression in mice fed a Western diet (Cecum)

2022-04-13 | GSE182456 | GEO

Raw potato starch alters the cecal microbiome and gene expression in mice fed a Western diet (Proximal Colon)

2022-04-13 | GSE182454 | GEO

RosselRatCecumMetagenome

Project description:Metagenome of rat cecum, 16s amplicon study

| PRJEB33989 | ENA

Experimental tests strongly challenge the evidence of a healthy human blood microbiome

Project description:The study critically evaluate the results of 16S targeted amplicon sequencing performed on the total DNA collected from healthy donors’ blood samples in the light of specific negative controls.

2024-03-01 | GSE254843 | GEO

Microbial communities in the gut of the beetle Odontotaenius disjunctus

Project description:16S amplicon pool analyses of the four gut sections of the wood-feeding beetle, Odontotaenius disjunctus The beetle is purely wood feeding, and we aim to first characterize the community that exist within the gut sections

2012-08-14 | GSE40067 | GEO

Hhigh-throughput sequencing of in vitro fecal fermentation samples

Project description:We report the use of high-throughput sequencing technology to detect the microbial composition and abundance of mice grastic contents before and after Helicobacter pylori infection or Lactobacillus paracasei ZFM54 pretreatment/treatment. The genomic DNA was obtained by the QIAamp PowerFecal DNA Kit. Then, the DNA samples were sent to BGI Genomics Co., Ltd. (Shenzhen, China) for V3-V4 region of the 16S rRNA gene high-throughput sequencing with an Illumina MiSeq platform. DNA samples were sequenced using primers 338F (forward primer sequence ACTCCTACGGGAGGCAGCAG)-806R (reverse primer sequence GGACTACHVGGGTWTCTAAT). The sequencing analyses were carried out using silva138/16s database as a reference for the assignation of Amplicon Sequence Variant (ASV) at 100% similarity.

2022-07-27 | GSE208665 | GEO

BBSRC_AMPLICON

Project description:16s Amplicon sequencing of GCB and Kadaknath breeds cecum samples

| PRJEB15079 | ENA

Microbial communities in the gut of the beetle Odontotaenius disjunctus

2012-08-13 | E-GEOD-40067 | biostudies-arrayexpress