Browse
Submit Data
Databases
API
Help

Dataset Information

0 Views

0 Connections

0 Citations

0 Reanalyses

0 Downloads

Omics score: 0

RNA profiles of polysomes from MOLM-13 cells treated with FLT3 inhibitor and/or mTOR inhibitor in the presence of conditioned media of bone marrow stomal cells

ABSTRACT: RNA profiles of polysomes from MOLM-13 cells treated with FLT3 inhibitor and/or mTOR inhibitor in the presence of conditioned media of bone marrow stomal cells

PROVIDER: PRJNA835090 | ENA |

REPOSITORIES: ENA

ACCESS DATA

Json Xml

Dataset's files

Source:

			Action	DRS
	SRR19091655_1.fastq.gz	Fastqsanger.gz
	SRR19091655_2.fastq.gz	Fastqsanger.gz
	SRR19091656_1.fastq.gz	Fastqsanger.gz
	SRR19091656_2.fastq.gz	Fastqsanger.gz
	SRR19091657_1.fastq.gz	Fastqsanger.gz

Items per page:

1 - 5 of 84

Similar Datasets

RNA profiles of polysomes from MOLM-13 cells treated with FLT3 inhibitor and/or mTOR inhibitor in the presence of conditioned media of bone marrow stomal cells

Project description:RNA-seq analysis of MOLM13 cells to compare mRNAs enriched in heavy polysomes post FLT3 inhibition and/or mTOR inhibition in the presence or absence of conditioned media of bone marrow stromal cells HS-5 (hBMSC-CM)

2022-10-19 | GSE202227 | GEO

RNA profiles of MOLM-13 cells treated with FLT3 inhibitor in the presence of conditioned media of bone marrow stromal cells

Project description:RNA-seq analysis of MOLM-13 cells to compare the gene expression profiles post FLT3 inhibition and/or ATM inhibition in the presence or absence of conditioned media of bone marrow stromal cell HS-5

2022-10-19 | GSE202229 | GEO

RNA profiles of MOLM-13 cells treated with FLT3 inhibitor in the presence of conditioned media of bone marrow stromal cells

Project description:RNA profiles of MOLM-13 cells treated with FLT3 inhibitor in the presence of conditioned media of bone marrow stromal cells

| PRJNA835089 | ENA

RNA-seq of the human acute myeloid leukemia cell line MOLM-13 treated with the METTL3 inhibitor UZH2 for 16 h compared to untreated controls

Project description:The METTL3 methyltransferase is responsible for the deposition of N6-methyladenosine (m6A) modifications in RNA and has been identified as essential for survival and proliferation of acute myeloid leukemia (AML) cells in a genome-wide CRISPR screen. In our experiments involving a small-molecule METTL3 inhibitor (UZH2) in the AML cell line MOLM-13, we observed suppression of cell proliferation, induction of apoptosis and differentiation. The aim of RNA-seq experiment was to characterize the transcriptomic changes occurring in MOLM-13 cell line after treatment UZH2. Cell were treated with 10 µM of UZH2 for 16 h and compered to untreated controls (5 % DMSO).

2022-10-01 | E-MTAB-11952 | biostudies-arrayexpress

DMSO control and DZNep treated MOLM-14 cells

Project description:We demonstrated that 3-Deazaneplanocin A (DZNep), a histone methyltransferase inhibitor, induce robust apoptosis in AML cells through increased ROS production and ER stress. We identified a core gene signature including TXNIP, a major redox control molecule which is crucial in DZNep-induced apoptosis. MOLM-14 cells were treated with DMSO and DZNep 2 µM for 24 hours

2011-07-01 | E-GEOD-30315 | biostudies-arrayexpress

Study of gene expression following Pim2 knockdown in FLT3-ITD-positive acute myeloid leukemia

Project description:The objective of the sudy is to explore the biological pathways controlled by Pim2 in FLT3-ITD positive AML We used microarrays to investigate gene expression in the MOLM-14 AML cell line in which Pim2 knockdown was induced by RNA interference (doxycycline-inducible shRNA)

2018-02-14 | GSE94870 | GEO

RNA-seq of MOLM-13 acute myeloid leukemia cell line treated with FIDAS-5

Project description:MOLM-13 acute myeloid leukemia cells were treated with 3 µM FIDAS-5 methionine S-adenosyltransferase 2A (MAT2A) inhibitor or 0.1% DMSO as control for 48 hours

2023-04-22 | E-MTAB-12847 | biostudies-arrayexpress

Phosphoproteome Analysis Reveals Differential Mode of Action of Sorafenib in Wildtype and Mutated FLT3 AML Cells

Project description:Constitutively activating internal tandem duplication (ITD) alterations of the receptor tyrosine kinase FLT3 (Fms-like tyrosine kinase 3) are common in acute myeloid leukemia (AML) and classifies FLT3 as an attractive therapeutic target. So far, application of FLT3 small molecule inhibitors such as Sorafenib has resulted only in partial and transient clinical responses in FLT3-ITD+ patients. Only recently, a prolonged event-free survival has been observed in AML patients who were treated with Sorafenib in addition to standard therapy. Here, we studied the Sorafenib effect on proliferation in a panel of 13 FLT3-ITD- and FLT3-ITD+ AML cell lines. Sorafenib IC50 values ranged from 0.001 to 5.6 µM, whereas FLT3-ITD+ cells (MOLM-13, MV4;11) were found more sensitive to Sorafenib than FLT3-ITD- cells. However, we identified two FLT3-ITD- cell lines (MONO-MAC-1 and OCI-AML-2) which were also Sorafenib sensitive. Phosphoproteome analyses revealed that the affected pathways differed in Sorafenib sensitive FLT3-ITD- and FLT3-ITD+ cells. In MV4;11 cells Sorafenib suppressed mTOR signalling by inhibiting direct inhibition of FLT3. In MONO-MAC-1 cells Sorafenib inhibited the MEK/ERK pathway by inhibition of the RET tyrosine kinase. These data suggest that the FLT3 status in AML patients might not be the only predictive factor for a response to Sorafenib.

2017-05-02 | PXD004442 | Pride

SYK Is a Critical Regulator of FLT3 In Acute Myeloid Leukemia

Project description:Cooperative dependencies between mutant oncoproteins and wild-type proteins are critical in cancer pathogenesis and therapy resistance. Although spleen tyrosine kinase (SYK) has been implicated in hematologic malignancies, it is rarely mutated. We used kinase activity profiling to identify collaborators of SYK in acute myeloid leukemia (AML) and determined that FMS-like tyrosine kinase 3 (FLT3) is transactivated by SYK via direct binding. Highly activated SYK is predominantly found in FLT3-ITD positive AML and cooperates with FLT3-ITD to activate MYC transcriptional programs. FLT3-ITD AML cells are more vulnerable to SYK suppression than FLT3 wild-type counterparts. In a FLT3-ITD in vivo model, SYK is indispensable for myeloproliferative disease (MPD) development, and SYK overexpression promotes overt transformation to AML and resistance to FLT3-ITD-targeted therapy. HL-60, MOLM-14, and U937 cell lines were transduced in triplicate with a control luciferase-directed shRNA (target sequence CCTAAGGTTAAGTCGCCCTCG), and in duplicate with two SYK-directed shRNAs: shSYK_1 (clone ID TRCN0000197257, target sequence GCAGCAGAACAGACATGTCAA) and shSYK_2 (clone ID TRCN0000003163 , target sequence GCAGGCCATCATCAGTCAGAA), and were then selected with 1 Âµg/ml puromycin 48 hours post-infection. At day 5 post-infection, RNA was extracted and profiled using HT HG-U133A arrays (Affymetrix) at the Broad Institute (Cambridge, MA, USA). The computational analysis of the gene expression data was performed through the Genome Space bioinformatics platform (http://www.genomespace.org).

2014-01-15 | E-GEOD-54065 | biostudies-arrayexpress

MZH29 is a novel potent FLT3 tyrosine kinase inhibitor with activity of overcoming drug resistant mutations in AML

Project description:In this study, we screened a group of newly synthesized tyrosine kinase inhibitors, and discovered MZH29 was a potent FLT3 inhibitor. Remarkably, MZH29 is well tolerated and effective in the clinically known FLT3 mutants in the constructed BaF3 model cells. MZH29 could also lead to complete tumor regression in the mouse xenograft model and increases survival in the bone marrow engraftment model. Further proteomics study indicates that the inhibition effects of MZH29 and AC220 are in a similar manner. All the results present here support that MZH29 could be a promising candidate for both the FLT3 WT and drug resistance mutant AML.

2016-12-12 | PXD004278 | Pride

OmicsDI is part of the ELIXIR infrastructure

OmicsDI is an Elixir interoperability service. Learn more ›

Tweets

OmicsDI Databases

PRIDE
PeptideAtlas
MassIVE
JPOST Repository
Physiome Model Repository

EGA
EVA
ENA
LINCS
PAXDB
Cell Collective

MetaboLights
Metabolomics Workbench
MetabolomeExpress
GNPS
BioModels
FAIRDOMHub

ArrayExpress
dbGaP
ExpressionAtlas
GEO
NODE

Information

Databases
Help
API
Contact us
Code on GitHub
Terms of use
Submit Data