Browse
Submit Data
Databases
API
Help

Dataset Information

0 Views

0 Connections

0 Citations

0 Reanalyses

0 Downloads

Omics score: 0

MRNAs encoding IL-12 and a decoy-resistant variant of IL-18 synergize to engineer T cells for efficacious intratumoral adoptive immunotherapy

ABSTRACT: mRNAs encoding IL-12 and a decoy-resistant variant of IL-18 synergize to engineer T cells for efficacious intratumoral adoptive immunotherapy

PROVIDER: PRJNA849586 | ENA |

REPOSITORIES: ENA

ACCESS DATA

Json Xml

Dataset's files

Source:

			Action	DRS
	SRR19663600_1.fastq.gz	Fastqsanger.gz
	SRR19663600_2.fastq.gz	Fastqsanger.gz
	SRR19663601_1.fastq.gz	Fastqsanger.gz
	SRR19663601_2.fastq.gz	Fastqsanger.gz
	SRR19663602_1.fastq.gz	Fastqsanger.gz

Items per page:

1 - 5 of 20

Similar Datasets

mRNAs encoding IL-12 and a decoy-resistant variant of IL-18 synergize to engineer T cells for efficacious intratumoral adoptive immunotherapy.

Project description:Interleukin-12 (IL-12) gene transfer enhances the therapeutic potency of adoptive T cell therapies. We previously reported that transient engineering of tumor-specific CD8 T cells with IL-12 mRNA enhanced their systemic therapeutic efficacy when delivered intratumorally. Here, we mix T cells engineered with mRNAs to express either single-chain IL-12 (scIL-12) or an IL-18 decoy-resistant variant (DRIL18) that is not functionally hampered by IL-18 binding protein (IL-18BP). These mRNA-engineered T cell mixtures are repeatedly injected into mouse tumors. Pmel-1 T cell receptor (TCR)-transgenic T cells electroporated with scIL-12 or DRIL18 mRNAs exert powerful therapeutic effects in local and distant melanoma lesions. These effects are associated with T cell metabolic fitness, enhanced miR-155 control on immunosuppressive target genes, enhanced expression of various cytokines, and changes in the glycosylation profile of surface proteins, enabling adhesiveness to E-selectin. Efficacy of this intratumoral immunotherapeutic strategy is recapitulated in cultures of tumor-infiltrating lymphocytes (TILs) and chimeric antigen receptor (CAR) T cells on IL-12 and DRIL18 mRNA electroporation.

| S-EPMC10040457 | biostudies-literature

mRNAs encoding IL-12 and a decoy-resistant variant of IL-18 synergize to engineer T cells for efficacious intratumoral adoptive immunotherapy

Project description:Mixtures of pmel-1 TCR-transgenic T cells electroporated with scIL-12 or DRIL-18 mRNAs exerted powerful therapeutic effects on injected and distant melanoma lesions. These effects are associated with T-cell metabolic fitness, changes in glycosylation of surface proteins gaining adhesiveness to E-selectin and enhanced miR-155 control on immunosuppressive target genes.

2023-03-08 | GSE206195 | GEO

TNF-alpha and IL-17 synergize to inhibit IL-13 bioactivity via IL-13Ra2 induction in human lung fibroblasts

Project description:IL-17 and TNF-alpha synergistically induce surface expression of IL-13Ra2 on primary lung fibroblasts, rendering them unresponsive to IL-13. Neutralizing antibodies to IL-13Ra2 restored IL-13-mediated signaling and transcriptome studies confirmed IL-13Ra2 is an IL-13 decoy receptor.

2014-12-31 | GSE56338 | GEO

Cell cycle motif decoy oligos

Project description:Single-stranded oligos listed below (and the corresponding reverse compliment) were synthesized and annealed: E2F: CTAGATTTCCCGCGGATC (decoy); CTAGACTCTGCTCGGATC (scrambled) KTGGYRSGAA: CTAGATTCCCGCCAAGGATC (decoy); CTAGACAGCTACTCCGGATC (scrambled) TGCGCANK: CTAGACATGCGCAGGATC (decoy); CTAGATCACAGGCGGATC (scrambled) CCAATNNSNNNGCG: CTAGACGCCCTCCGATTGGGGATC (decoy); CTAGATGCACGCTCGGTCCGGATC (scrambled) ACTWSNACTNY: CTAGAGGAGTTGTAGTGGATC (decoy); CTAGAGATAGTGTGTGGGATC (scrambled) HeLa cells were propagated in DMEM (Invitrogen) plus 10% FBS and transfected with 0.5 uM of double-stranded DNA. Total RNA was extracted with TRIzol (Invitrogen) from HeLa cells 2 d after transfection of the indicated decoy oligo or scrambled oligo in duplicate. RNA was amplified using the Ambion Amino Allyl MessageAmp II aRNA kit. For each motif, decoy oligo transfected samples (labeled with Cy5) and the corresponding scrambled oligo transfected samples (labeled with Cy3) were competitively hybridized to HEEBO microarrays as described (http://www.microarray.org/sfgf/heebo.do). genetic_modification_design

2012-08-23 | E-GEOD-39572 | biostudies-arrayexpress

Cell cycle motif decoy oligos

2012-08-23 | GSE39572 | GEO

Expression data from U87-2M1 glioma cells transduced with baculoviral control decoy vector or baculoviral miR-10b decoy vector

Project description:MicroRNA-10b may target numerous genes in gliomagenesis. The target genes of miR-10b may differ according to the cellular context. We used microarray analyses to determine the phenotypic effects and gene targets of miR-10b by silencing miR-10b in invasive U87-2M1 glioma cells. Early passage U87-2M1 cells treated with the baculoviral control decoy vector or miR-10b decoy vector were selected for RNA extraction and hybridization on microarray

2012-12-31 | E-GEOD-35170 | biostudies-arrayexpress

IL-18 engineered to avoid decoy-receptor binding enhances tumor rejection by anti-CTLA-4 in kidney cancer models through immune microenvironment remodeling.

Project description:The cytokine interleukin-18 (IL-18) has immunostimulatory effects but is negatively regulated by a secreted binding protein, IL-18BP, that limits IL-18’s anti-cancer efficacy. A “decoy-resistant” form of IL-18 (DR-18), that avoids sequestration by IL-18BP while maintaining its immunostimulatory potential has recently been developed. Here, we investigate the therapeutic potential of DR-18 in renal cell carcinoma (RCC). We used immunocompetent RCC murine models to assess the efficacy of DR-18 in combination with single- and dual-agent anti-PD-1 and anti-CTLA-4. In contrast to preclinical models of other tumor types, in RCC models DR-18 enhanced the activity of anti-CTLA-4 but not anti-PD-1 treatment. This activity correlated with intra-tumoral enrichment and clonal expansion of effector CD8+ T cells, decreased regulatory T cell levels, and enrichment of pro-inflammatory, anti-tumor myeloid cell populations, as assessed by scRNA- and scTCR-seq.

2024-11-01 | GSE279662 | GEO

Spatial microniches of IL-2 synergize with IL-10 to drive lung migratory Th2 cells in response to inhaled allergen

Project description:Spatial microniches of IL-2 synergize with IL-10 to drive lung migratory Th2 cells in response to inhaled allergen

| PRJNA1026951 | ENA

Spatial microniches of IL-2 synergize with IL-10 to drive lung migratory Th2 cells in response to inhaled allergen [Curio]

Project description:Spatial microniches of IL-2 synergize with IL-10 to drive lung migratory Th2 cells in response to inhaled allergen [Curio]

| PRJNA1026958 | ENA

Specific inhibition of splicing factor activity by decoy RNA oligonucleotides

Project description:Alternative splicing, a fundamental step in gene expression, is deregulated in many diseases. Splicing factors (SFs), which regulate this process, are up- or down regulated or mutated in several diseases including cancer. To date, there are no inhibitors that directly inhibit the activity of SFs. We designed decoy oligonucleotides, composed of several repeats of a RNA motif, which is recognized by a single SF. Here we show that decoy oligonucleotides targeting splicing factors RBFOX1/2, SRSF1 and PTBP1, can specifically bind to their respective SFs and inhibit their splicing and biological activities both in vitro and in vivo. These decoy oligonucleotides present a novel approach to specifically downregulate SF activity and have the potential to treat diseases where SFs are up-regulated, such as cancer.

2019-02-14 | GSE126503 | GEO

OmicsDI is part of the ELIXIR infrastructure

OmicsDI is an Elixir interoperability service. Learn more ›

Tweets

OmicsDI Databases

PRIDE
PeptideAtlas
MassIVE
JPOST Repository
Physiome Model Repository

EGA
EVA
ENA
LINCS
PAXDB
Cell Collective

MetaboLights
Metabolomics Workbench
MetabolomeExpress
GNPS
BioModels
FAIRDOMHub

ArrayExpress
dbGaP
ExpressionAtlas
GEO
NODE

Information

Databases
Help
API
Contact us
Code on GitHub
Terms of use
Submit Data