Siler collingwoodi, Toxeus maxillosus
Ontology highlight
ABSTRACT:
PROVIDER: PRJNA852482 | ENA |
REPOSITORIES: ENA
Similar Datasets
Project description:Morus alba L. Raw protein sequence reads and sequence
2024-02-08 | PXD049451 |
Project description:We report the use of high-throughput sequencing technology to detect the microbial composition and abundance of human feces after in vitro co-fermentation with citrus peel flavonoid extracts. The genomic DNA was obtained by the QIAamp PowerFecal DNA Kit. Then, the DNA samples were sent to Biomarker Bio-Tech (Beijing, China) for V3-V4 region of the 16S rDNA gene high-throughput sequencing with an Illumina MiSeq platform. DNA samples were sequenced using primers 338F (forward primer sequence ACTCCTACGGGAGGCAGCAG)-806R (reverse primer sequence GGACTACHVGGGTWTCTAAT). A total of 8,816,250 pairs of Reads were obtained from the 112 samples sequenced, and 8,721,112 Clean Reads were generated from the double-ended Reads after quality control and splicing. The sequencing analyses were carried out using the SILVA database as a reference for the assignation of operational taxonomic units (OTUs) with 97% of identity.
2022-04-02 | GSE199749 | GEO
Project description:bacteria strain:16S rDNA | isolate:16S rDNA Raw sequence reads
| PRJNA301176 | ENA
Project description:biofilm 16s rDNA Raw sequence reads
| PRJNA1154400 | ENA
Project description:Over 2000 publicly accessible human and mouse ChIP-Seq datasets for about 250 Transcription Factors and chromatin complexes from various databases (ENCODE, GEO) were mapped to custom-made human and mouse genomes containing a reference rDNA sequence of the appropriate species (Genbank U13369.1 for human, BK000964.3 for mouse). The read mapping density across the rDNA sequence was then extracted and normalized to the median in that dataset. Unbiased clustering and analysis, followed by curation, was performed to identify high-confidence patterns of rDNA occupancy for numerous hematopoietic TFs and TF families at canonical TF motif sequences. ************************ Data processing steps: FASTQs were trimmed using Trimmomatic with the following parameters: LEADING:3 TRAILING:3 SLIDINGWINDOW:4:15 MINLEN:30 Reads were mapped to customized genomes (containing additional rDNA sequence) using Bowtie2 using the following parameter: -X 2000 Read density across the rDNA sequence was extracted using igvtools ************************
2022-01-15 | GSE191272 | GEO
Project description:The Root-lesion nematode (RLN) Pratylenchus coffeae is a major ramie pest causing severe fiber yield loss annual in China. The response mechanism of ramie to RLN-infection is poorly understood. Two RLN-infected plants (Inf1 and Inf2) and two control plants (CO1 and CO2) were individually used to sequence by Illumina pair-end sequencing. About 56.3, 51.7, 43.4 and 45.0 million sequencing reads were generated from the libraries of CO1, CO2, Inf1 and Inf2, respectively. De novo assembly for these 196 million reads yielded 50,486 unigenes with an average length of 853.3 bp. Based on sequence similarity search with known proteins, a total of 24,820 (49.2%) genes were annotated for their function. Comparison of gene expression level between CO and Inf ramie based on the normalized value of read counts per kilobase of exon model per million reads (RPKM) revealed that there were 777 differentially expressed genes (DEGs). Further, these functional category of DEGs were classified by assigning them to gene ontology (GO) and clusters of orthologous group (COG). Pathway enrichment analysis showed that three pathways (Phenylalanine metabolism, Carotenoid biosynthesis and Phenylpropanoid biosynthesis) were severely influenced by RLN-infection. The genome-wide expression profiling of ramie responding to RLN-infection was first characterized. A series of candidate genes and pathways that may contribute to defense response against RLN in ramie will be helpful for further improving the resistance to RLN-infection. A total of four samples, two replicates of control plant (CO1 and CO2) and two replicates of RLN-infected plants (Inf1 and Inf2) were used for RNA-seq.
2014-04-28 | E-GEOD-51900 | biostudies-arrayexpress
Project description:16s rDNA freshwater microbiome Raw sequence reads
| PRJNA543623 | ENA