Ontology highlight
ABSTRACT:
PROVIDER: PRJNA862989 | ENA |
REPOSITORIES: ENA
Dataset's files
| Action | DRS | |||
|---|---|---|---|---|
| SRR20681000.fastq.gz | Fastqsanger.gz | |||
| SRR20681001.fastq.gz | Fastqsanger.gz | |||
| SRR20681002.fastq.gz | Fastqsanger.gz | |||
| SRR20681003.fastq.gz | Fastqsanger.gz | |||
| SRR20680904.fastq.gz | Fastqsanger.gz |
Items per page: 5 1 - 5 of 132 |
Similar Datasets
Project description:Structural Basis for Target-Directed MicroRNA Degradation
| PRJNA540836 | ENA
Project description:Clustered regularly interspaced short palindromic repeat (CRISPR) RNA-guided nucleases have gathered considerable excitement as a tool for genome engineering. However, questions remain about the specificity of their target site recognition. Most previous studies have examined predicted off-target binding sites that differ from the perfect target site by one to four mismatches, which represent only a subset of genomic regions. Here, we used ChIP-seq to examine genome-wide CRISPR binding specificity at gRNA-specific and gRNA-independent sites. For two guide RNAs targeting the murine Snurf gene promoter, we observed very high binding specificity at the intended target site while off-target binding was observed at 2- to 6-fold lower intensities. We also identified significant gRNA-independent off-target binding. Interestingly, we found that these regions are highly enriched in the PAM site, a sequence required for target site recognition by CRISPR. To determine the relationship between Cas9 binding and endonuclease activity, we used targeted sequence capture as a high-throughput approach to survey a large number of the potential off-target sites identified by ChIP-seq or computational prediction. A high frequency of indels was observed at both target sites and one off-target site, while no cleavage activity could be detected at other ChIP-bound regions. Our results demonstrate that even a simple configuration of a Cas9:gRNA nuclease can support very specific DNA cleavage activity and that most interactions between the CRISPR nuclease complex and genomic PAM sites do not lead to DNA cleavage. ChIP-seq using dCas9 to determine genome-wide binding of CRISPR/Cas9 noED: Cas9 doublemutant protein without an effector domain KRAB: Cas9 doublemutant protein fused to the KRAB repressor domain S1 gRNA: guide RNA targeting GCTCCCTACGCATGCGTCCC(AGG) in the mouse genome S2 gRNA: guide RNA targeting AATGGCTCAGGTTTGTCGCG(CGG) in the mouse genome VEGFA TS3 gRNA: guide RNA targeting GGTGAGTGAGTGTGTGCGTG(TGG) in the human genome
2015-03-04 | E-GEOD-61099 | biostudies-arrayexpress
Project description:By a robust unbiased ChIP-seq approach, we demonstrated that CRISPR/Cas9 had crRNA-specific off-target binding activities in human genome. However, most of those binding off-targets could not be efficiently cleaved both in vivo and in vitro which suggested the cleavage off-target activity of CRISPR/Cas9 in human genome is very limited. We provided a valuable tool to further investigate the molecular mechanism of CRISPR/Cas9 and to optimize its in vivo targeting sgRNA binding sites were identified with ChipSeq by using GFP antibody (there are 2 replicates for egfa-t1 sgRNA,emx1 sgRNA and control without sgRNA in Hek293T cells, one egfa-t1 sgRNA,emx1 sgRNA and control without sgRNA in HeLaS3 cells)
2014-06-18 | E-GEOD-58511 | biostudies-arrayexpress
Project description:To study target sequence specificity, selectivity, and reaction kinetics of Streptococcus pyogenes Cas9 activity, we challenged libraries of random variant targets with purified Cas9::guide RNA complexes in vitro. Cleavage kinetics were nonlinear, with a burst of initial activity followed by slower sustained cleavage. Consistent with other recent analyses of Cas9 sequence specificity, we observe considerable (albeit incomplete) impairment of cleavage for targets mutated in the PAM sequence or in "seed" sequences matching the proximal 8 bp of the guide. A second target region requiring close homology was located at the other end of the guide::target duplex (positions 13-18 relative to the PAM). Strikingly, a subset of variants which broke homology in the intervening region consistently increased the capacity of Cas9 to cleave in extended reactions. Sequences flanking the guide+PAM region had measurable (albeit modest) effects on cleavage. Taken together, these studies provide both a basis for predicting effective cleavage targets and a basis for potential optimization of guide RNAs to yield efficiency beyond that of the simple perfect-match guides.
2014-11-14 | GSE58426 | GEO
Project description:Use DNase-seq to assess genome-wide chromation remodeling which occurred in CRISPR/Cas9 and TALE genome engineering systems Determining chromatin structural changes in transfected cells vs. the parent HEK293T cells
2015-05-28 | E-GEOD-67007 | biostudies-arrayexpress
Project description:We sought to characterise how chromatin states affected CRISPR/Cas9 activity and the induced indel profiles. We used two different doses of Trichostatin and two different doses of a EZH2 inhibitor to modulate the chromatin state and then performed targeted DNA-seq of selected sgRNA target regions to identify the indels.
2018-12-13 | E-MTAB-7091 | biostudies-arrayexpress
Project description:RNA-guided genome editing with the CRISPR-Cas9 system has great potential for basic and clinical research, but the determinants of targeting specificity and the extent of off-target cleavage remain insufficiently understood. Using chromatin immunoprecipitation and high-throughput sequencing (ChIP-seq), we mapped genome-wide binding sites of catalytically inactive Cas9 (dCas9) in HEK293T cells, in combination with 12 different single guide RNAs (sgRNAs). The number of off-target sites bound by dCas9 varied from ~10 to >1,000 depending on the sgRNA. Analysis of off-target binding sites showed the importance of the PAM-proximal region of the sgRNA guiding sequence and that dCas9 binding sites are enriched in open chromatin regions. When targeted with catalytically active Cas9, some off-target binding sites had indels above background levels in a region around the ChIP-seq peak, but generally at lower rates than the on-target sites. Our results elucidate major determinants of Cas9 targeting, and we show that ChIP-seq allows unbiased detection of Cas9 binding sites genome-wide 1.sgRNA1-6 binding sites were identified with ChipSeq by using HA antibody (there are 2 replicates for sgRNA1-3, one sample for sgRNA4-6,one control without sgRNA) 2.PCR products which amplifies " off-target genomic sites" were deep sequenced in the presence of WT Cas9+sgRNA or WT Cas9 alone( unique adaptor was used for each sgRNA and mixed for multiplex run)
2014-05-18 | E-GEOD-55887 | biostudies-arrayexpress
Project description:In E. coli, editing efficiency (EE) with Cas9-mediated recombineering varies across targets due to differences in the level of Cas9:gRNA DNA double-strand break (DSB)-induced cell death. We found that EE with the same gRNA and repair template can also change with target position, cas9 promoter strength, and growth conditions. Incomplete editing, off-target activity, non-targeted mutations, and failure to cleave target DNA even if Cas9 is bound also compromise EE. These effects on EE were gRNA-specific. We propose that differences in the efficiency of Cas9:gRNA-mediated DNA DSBs and differences in rates of dissociation of Cas9:gRNA complexes from target sites account for the observed variations in EE between gRNAs. We show that editing behavior using the same gRNA can be modified by mutating the gRNA spacer, which changes the DNA DSB activity. Finally, we discuss how variable editing with different gRNAs could limit high-throughput applications and provide strategies to overcome these limitations.
2020-06-06 | GSE132139 | GEO
Project description:Background The safety of CRISPR-based gene editing methods is of the utmost priority in clinical applications. Previous studies have reported that Cas9 cleavage induced frequent aneuploidy in primary human T cells, but whether cleavage-mediated editing of base editors would generate off-target structure variations remains unknown. Here, we investigated the potential off-target structural variations associated with CRISPR/Cas9, ABE and CBE editing in mouse embryos and primary human T cells by whole-genome sequencing and single-cell RNA-seq analyses. Results The results showed that both Cas9 and ABE generated off-target structural variations (SVs) in mouse embryos, while CBE induced rare SVs. In addition, off-target large deletions were detected in 32.74% of primary human T cells transfected with Cas9 and 9.17% of cells transfected with ABE. Moreover, Cas9-induced aneuploid cells activated the P53 and apoptosis pathways, whereas ABE-associated aneuploid cells significantly upregulated cell cycle-related genes and arrested in G0 phase. A percentage of 16.59% and 4.29% aneuploid cells were still observable at 3 weeks post transfection of Cas9 or ABE. These off-target phenomena in ABE were universal as observed in other cell types such as B cells and Huh7. Furthermore, the off-target SVs were significantly reduced in cells treated with high-fidelity ABE (ABE-V106W). Conclusions This study raises urgent need for minimizing the off-target SVs of CRISPR/Cas9 and ABE.
2024-11-01 | GSE280767 | GEO