Ontology highlight
ABSTRACT:
PROVIDER: PRJNA865310 | ENA |
REPOSITORIES: ENA
Dataset's files
| Action | DRS | |||
|---|---|---|---|---|
| SRR20961330.fastq.gz | Fastqsanger.gz | |||
| SRR20961331.fastq.gz | Fastqsanger.gz | |||
| SRR20961332.fastq.gz | Fastqsanger.gz | |||
| SRR20961333.fastq.gz | Fastqsanger.gz | |||
| SRR20961334.fastq.gz | Fastqsanger.gz |
Items per page: 5 1 - 5 of 17 |
Similar Datasets
Project description:Clustered regularly interspaced short palindromic repeat (CRISPR) RNA-guided nucleases have gathered considerable excitement as a tool for genome engineering. However, questions remain about the specificity of their target site recognition. Most previous studies have examined predicted off-target binding sites that differ from the perfect target site by one to four mismatches, which represent only a subset of genomic regions. Here, we used ChIP-seq to examine genome-wide CRISPR binding specificity at gRNA-specific and gRNA-independent sites. For two guide RNAs targeting the murine Snurf gene promoter, we observed very high binding specificity at the intended target site while off-target binding was observed at 2- to 6-fold lower intensities. We also identified significant gRNA-independent off-target binding. Interestingly, we found that these regions are highly enriched in the PAM site, a sequence required for target site recognition by CRISPR. To determine the relationship between Cas9 binding and endonuclease activity, we used targeted sequence capture as a high-throughput approach to survey a large number of the potential off-target sites identified by ChIP-seq or computational prediction. A high frequency of indels was observed at both target sites and one off-target site, while no cleavage activity could be detected at other ChIP-bound regions. Our results demonstrate that even a simple configuration of a Cas9:gRNA nuclease can support very specific DNA cleavage activity and that most interactions between the CRISPR nuclease complex and genomic PAM sites do not lead to DNA cleavage. ChIP-seq using dCas9 to determine genome-wide binding of CRISPR/Cas9 noED: Cas9 doublemutant protein without an effector domain KRAB: Cas9 doublemutant protein fused to the KRAB repressor domain S1 gRNA: guide RNA targeting GCTCCCTACGCATGCGTCCC(AGG) in the mouse genome S2 gRNA: guide RNA targeting AATGGCTCAGGTTTGTCGCG(CGG) in the mouse genome VEGFA TS3 gRNA: guide RNA targeting GGTGAGTGAGTGTGTGCGTG(TGG) in the human genome
2015-03-04 | E-GEOD-61099 | biostudies-arrayexpress
Project description:The type V-I CRISPR-Cas system is becoming increasingly attractive for its potential utility in gene editing. However, natural nucleases often exhibit low efficiency, limiting their application. Here, we utilized structure-guided rational design and combinatorial protein engineering to optimize an uncharacterized Cas12i nuclease, Cas12i3. Accordingly, we developed Cas-SF01, a Cas12i3 variant that exhibits significantly improved gene-editing activity in mammalian cells and plants. Cas-SF01 displays comparable or superior editing performance compared to SpCas9 or recently engineered Cas12 nucleases. Further analysis of PAM recognition showed that Cas-SF01 has an expanded PAM range and effectively recognizes NTTN and noncanonical NATN and TTVN PAMs. Additionally, we identified an amino acid substitution, D876R, that markedly reduced the off-target effect while maintaining high on-target activity, leading to the development of Cas-SF01HiFi (high-fidelity Cas-SF01). Finally, we demonstrated that Cas-SF01 has robust gene-editing activity in both the monocot plant rice and dicot plant pepper. Our results suggest that Cas-SF01 can serve as a robust gene-editing platform with high efficiency and specificity for future genome editing applications across different organisms.
2023-11-05 | GSE236755 | GEO
Project description:We report the PAMs of diverse type I-E CRISPR- Cas systems and the type I-C and the type I-F1 CRISPR-Cas systems from Xanthomonas albilineans. Furthermore, we report PAMs of two type I-B CRISPR transposons (CASTs) and the Vibrio cholerae type I-F CAST. For identification of the PAMs, we used a cell-free TXTL-based PAM screen we named PAM-DETECT. By adding a 5N randomized PAM library and plasmids encoding for Cascade genes and gRNAs, recognized PAMs were bound by Cascade and protected from cleavage by a restriction enzyme that has it's recognition site within the target region. By amplifying the non-cleaved target plasmid, we used next-generation sequencing to analyze the enrichment of functional PAMs of the studied CRISPR-Cas systems. We additionally assessed the insertion sites of crRNA-dependent and crRNA-independent transposition of the Rippkaea orientalis type I-B CAST in TXTL and E. coli.
2022-02-24 | GSE179614 | GEO
Project description:We report the PAMs of phylogenetically-diverse Cas12a nucleases using a cell-free TXTL-based PAM screen. By adding a 5N randomized PAM library and Cas12a-gRNA in vitro, recognized PAM sequences were cleaved, while non-recognized PAMs remained. By amplifying the non-cleaved DNA, we used next-generation sequencing to analyze the depletion of functional PAMs of these Cas12a nucleases.
2020-03-02 | GSE130377 | GEO
Project description:C-to-T base editing mediated by CRISPR/Cas9 base editors (BEs) needs a G/C-rich PAM and the editing fidelity is compromised by unwanted indels and non-C-to-T substitutions. We developed CRISPR/Cpf1-based BEs to recognize a T-rich PAM and induce efficient C-to-T editing with few indels and/or non-C-to-T substitutions. The requirement of editing fidelity in therapeutic-related trials necessitates the development of CRISPR/Cpf1-based BEs, which also facilitates base editing in A/T-rich regions.
2018-10-16 | GSE105002 | GEO
Project description:Clustered regularly interspaced short palindromic repeat (CRISPR) RNA-guided nucleases have gathered considerable excitement as a tool for genome engineering. However, questions remain about the specificity of their target site recognition. Most previous studies have examined predicted off-target binding sites that differ from the perfect target site by one to four mismatches, which represent only a subset of genomic regions. Here, we used ChIP-seq to examine genome-wide CRISPR binding specificity at gRNA-specific and gRNA-independent sites. For two guide RNAs targeting the murine Snurf gene promoter, we observed very high binding specificity at the intended target site while off-target binding was observed at 2- to 6-fold lower intensities. We also identified significant gRNA-independent off-target binding. Interestingly, we found that these regions are highly enriched in the PAM site, a sequence required for target site recognition by CRISPR. To determine the relationship between Cas9 binding and endonuclease activity, we used targeted sequence capture as a high-throughput approach to survey a large number of the potential off-target sites identified by ChIP-seq or computational prediction. A high frequency of indels was observed at both target sites and one off-target site, while no cleavage activity could be detected at other ChIP-bound regions. Our results demonstrate that even a simple configuration of a Cas9:gRNA nuclease can support very specific DNA cleavage activity and that most interactions between the CRISPR nuclease complex and genomic PAM sites do not lead to DNA cleavage.
2015-03-04 | GSE61099 | GEO
Project description:The targeting range of CRISPR-Cas9 base editors (BEs) is limited by their G/C-rich PAM sequences. To overcome this limitation, we developed a CRISPR/Cpf1-based BE by fusing the rat cytosine deaminase APOBEC1 to a catalytically inactive version of Lachnospiraceae bacterium Cpf1. The base editor recognizes a T-rich PAM sequence and converts C to T in human cells with low levels of indels, non-C-to-T substitutions and off-target editing.
2018-03-18 | GSE110136 | GEO
Project description:The development of CRISPR-Cas systems for targeting DNA and RNA in diverse organisms has transformed biotechnology and biological research. Moreover, the CRISPR revolution has highlighted bacterial adaptive immune systems as a rich and largely unexplored frontier for discovery of new genome engineering technologies. In particular, the class 2 CRISPR-Cas systems, which use single RNA-guided DNA-targeting nucleases such as Cas9, have been widely applied for targeting DNA sequences in eukaryotic genomes. Here, we report DNA-targeting and transcriptional control with class I CRISPR-Cas systems. Specifically, we repurpose the effector complex from type I variants of class 1 CRISPR-Cas systems, the most prevalent CRISPR loci in nature, that target DNA via a multi-component RNA-guided complex termed Cascade. We validate Cascade expression, complex formation, and nuclear localization in human cells and demonstrate programmable CRISPR RNA (crRNA)-mediated targeting of specific loci in the human genome. By tethering transactivation domains to Cascade, we modulate the expression of targeted chromosomal genes in both human cells and plants. This study expands the toolbox for engineering eukaryotic genomes and establishes Cascade as a novel CRISPR-based technology for targeted eukaryotic gene regulation.
2019-06-26 | GSE114858 | GEO
Project description:In this work the favorable PAM sequences for a type IV-A CRISPR-Cas system were determined
2022-08-19 | GSE211446 | GEO