Ontology highlight
ABSTRACT:
PROVIDER: PRJNA607069 | ENA |
REPOSITORIES: ENA
Dataset's files
| Action | DRS | |||
|---|---|---|---|---|
| SRR11096038.fastq.gz | Fastqsanger.gz | |||
| SRR11096039.fastq.gz | Fastqsanger.gz | |||
| SRR11096040.fastq.gz | Fastqsanger.gz | |||
| SRR11096041.fastq.gz | Fastqsanger.gz | |||
| SRR11096042.fastq.gz | Fastqsanger.gz |
Items per page: 5 1 - 5 of 30 |
Similar Datasets
Project description:Clustered regularly interspaced short palindromic repeat (CRISPR) RNA-guided nucleases have gathered considerable excitement as a tool for genome engineering. However, questions remain about the specificity of their target site recognition. Most previous studies have examined predicted off-target binding sites that differ from the perfect target site by one to four mismatches, which represent only a subset of genomic regions. Here, we used ChIP-seq to examine genome-wide CRISPR binding specificity at gRNA-specific and gRNA-independent sites. For two guide RNAs targeting the murine Snurf gene promoter, we observed very high binding specificity at the intended target site while off-target binding was observed at 2- to 6-fold lower intensities. We also identified significant gRNA-independent off-target binding. Interestingly, we found that these regions are highly enriched in the PAM site, a sequence required for target site recognition by CRISPR. To determine the relationship between Cas9 binding and endonuclease activity, we used targeted sequence capture as a high-throughput approach to survey a large number of the potential off-target sites identified by ChIP-seq or computational prediction. A high frequency of indels was observed at both target sites and one off-target site, while no cleavage activity could be detected at other ChIP-bound regions. Our results demonstrate that even a simple configuration of a Cas9:gRNA nuclease can support very specific DNA cleavage activity and that most interactions between the CRISPR nuclease complex and genomic PAM sites do not lead to DNA cleavage. ChIP-seq using dCas9 to determine genome-wide binding of CRISPR/Cas9 noED: Cas9 doublemutant protein without an effector domain KRAB: Cas9 doublemutant protein fused to the KRAB repressor domain S1 gRNA: guide RNA targeting GCTCCCTACGCATGCGTCCC(AGG) in the mouse genome S2 gRNA: guide RNA targeting AATGGCTCAGGTTTGTCGCG(CGG) in the mouse genome VEGFA TS3 gRNA: guide RNA targeting GGTGAGTGAGTGTGTGCGTG(TGG) in the human genome
2015-03-04 | E-GEOD-61099 | biostudies-arrayexpress
Project description:Clustered regularly interspaced short palindromic repeat (CRISPR) RNA-guided nucleases have gathered considerable excitement as a tool for genome engineering. However, questions remain about the specificity of their target site recognition. Most previous studies have examined predicted off-target binding sites that differ from the perfect target site by one to four mismatches, which represent only a subset of genomic regions. Here, we used ChIP-seq to examine genome-wide CRISPR binding specificity at gRNA-specific and gRNA-independent sites. For two guide RNAs targeting the murine Snurf gene promoter, we observed very high binding specificity at the intended target site while off-target binding was observed at 2- to 6-fold lower intensities. We also identified significant gRNA-independent off-target binding. Interestingly, we found that these regions are highly enriched in the PAM site, a sequence required for target site recognition by CRISPR. To determine the relationship between Cas9 binding and endonuclease activity, we used targeted sequence capture as a high-throughput approach to survey a large number of the potential off-target sites identified by ChIP-seq or computational prediction. A high frequency of indels was observed at both target sites and one off-target site, while no cleavage activity could be detected at other ChIP-bound regions. Our results demonstrate that even a simple configuration of a Cas9:gRNA nuclease can support very specific DNA cleavage activity and that most interactions between the CRISPR nuclease complex and genomic PAM sites do not lead to DNA cleavage.
2015-03-04 | GSE61099 | GEO
Project description:Genome editing typically involves recombination between donor nucleic acids and genomic sequences subjected to double-stranded DNA breaks (DSBs) made by programmable nucleases (e.g. CRISPR-Cas9). Yet, amongst other deleterious by-products, DSBs yield translocations, off-target mutations and, most pervasively, unpredictable on-target allelic disruptions. Remarkably, hitherto, the untoward phenotypic consequences of on-target disruptions at allelic and non-allelic (e.g. pseudogene) sequences have received scant scrutiny and, crucially, remain to be addressed. Here, we demonstrate that gene-edited cells can lose fitness due to on-target DSBs and report that simultaneous single-stranded DNA break formation at donor and target DNA by CRISPR-Cas9 “nickases” overcomes, to a great extent, such genotype-phenotype disrupting events. Moreover, in trans paired nicking gene editing can efficiently and precisely add large DNA segments (i.e. live-cell reporter tags) into essential and multiple-copy genomic sequences while circumventing most of the allelic and non-allelic collateral mutations and chromosomal rearrangements characteristic of nuclease-dependent gene editing procedures.
2019-12-04 | GSE135064 | GEO
Project description:Programmable editing of a target base in genomic DNA without double-stranded DNA cleavage
| PRJNA316460 | ENA
Project description:We report the PAMs of diverse type I-E CRISPR- Cas systems and the type I-C and the type I-F1 CRISPR-Cas systems from Xanthomonas albilineans. Furthermore, we report PAMs of two type I-B CRISPR transposons (CASTs) and the Vibrio cholerae type I-F CAST. For identification of the PAMs, we used a cell-free TXTL-based PAM screen we named PAM-DETECT. By adding a 5N randomized PAM library and plasmids encoding for Cascade genes and gRNAs, recognized PAMs were bound by Cascade and protected from cleavage by a restriction enzyme that has it's recognition site within the target region. By amplifying the non-cleaved target plasmid, we used next-generation sequencing to analyze the enrichment of functional PAMs of the studied CRISPR-Cas systems. We additionally assessed the insertion sites of crRNA-dependent and crRNA-independent transposition of the Rippkaea orientalis type I-B CAST in TXTL and E. coli.
2022-02-24 | GSE179614 | GEO
Project description:CRISPR-Cas is an RNA-based defense system that enables prokaryotes to recognize invading foreign DNA by cognate crRNA guides and destroy it by CRISPR-associated Cas nucleases 1,2 . Elucidation of the interference mechanism of the Streptococcus pyogenes Type II CRISPR- Cas9 system has allowed for the successful repurposing of SpCas9 as a generic genome editing tool, with great promise for human gene therapy 3 . However, especially for therapeutic applications, some caution seems appropriate, because Cas9 systems from some human pathogens may induce a cytotoxic response via an unknown mechanism 4 . Here we show that when released in human cells, Cas9 nucleases from the pathogenic bacteria Campylobacter jejuni and S. pyogenes have the potential to cause severe DNA damage. In the absence of a CRISPR RNA guide, native Cas9 nucleases from both pathogens enter the host nucleus, where their presence leads to promiscuous double stranded DNA breaks (DSBs) and induction of cell death. DSB induction can be reduced to background levels either by saturation of CjCas9 and SpCas9 with crRNA guides or by inactivating their nuclease activity. Our results demonstrate that guide-free Cas9 of bacterial pathogens might play an important role in pathogenicity. Furthermore, we propose that saturating Cas9 with appropriate guide RNAs is crucial for efficient and safe therapeutic applications.
2022-03-02 | PXD006712 | Pride
Project description:We report the PAMs of phylogenetically-diverse Cas12a nucleases using a cell-free TXTL-based PAM screen. By adding a 5N randomized PAM library and Cas12a-gRNA in vitro, recognized PAM sequences were cleaved, while non-recognized PAMs remained. By amplifying the non-cleaved DNA, we used next-generation sequencing to analyze the depletion of functional PAMs of these Cas12a nucleases.
2020-03-02 | GSE130377 | GEO