Browse
Submit Data
Databases
API
Help

Dataset Information

0 Views

0 Connections

0 Citations

0 Reanalyses

0 Downloads

Omics score: 0

ABSTRACT: 16S and ITS High-throughput sequencing of rhizosphere microbes

PROVIDER: PRJNA903756 | ENA |

REPOSITORIES: ENA

ACCESS DATA

Json Xml

Dataset's files

Source:

			Action	DRS
	SRR22394349_1.fastq.gz	Fastqsanger.gz
	SRR22394349_2.fastq.gz	Fastqsanger.gz
	SRR22394350_1.fastq.gz	Fastqsanger.gz
	SRR22394350_2.fastq.gz	Fastqsanger.gz
	SRR22394351_1.fastq.gz	Fastqsanger.gz

Items per page:

1 - 5 of 36

Similar Datasets

Structure and variation in microbiome from continuous and rotational Pinellia ternata cropping soils

Project description:We used wheat as rotational crop to assess the influence of continuous cropping on microbiome in Pinellia ternata rhizosphere and the remediation of rotational cropping to the impacted microbiota. Illumina high-throughput sequencing technology was utilized for this method to explore the rhizosphere microbial structure and diversity based on continuous and rotational cropping.

2016-12-10 | GSE91083 | GEO

Project description:16s high-throughput sequencing data of potting rhizosphere soil

| PRJNA1130713 | ENA

Plant and bird presence strongly influences the microbial communities in soils of Admiralty Bay, Maritime Antarctica

Project description:Understanding the environmental factors that shape microbial communities is crucial, especially in extreme environments, like Antarctica. Two main forces were reported to influence Antarctic soil microbes: birds and plants. Both birds and plants are currently undergoing unprecedented changes in their distribution and abundance due to global warming. However, we need to clearly understand the relationship between plants, birds and soil microorganisms. We therefore collected rhizosphere and bulk soils from six different sampling sites subjected to different levels of bird influence and colonized by Colobanthus quitensis and Deschampsia antarctica in the Admiralty Bay, King George Island, Maritime Antarctic. Microarray and qPCR assays targeting 16S rRNA genes of specific taxa were used to assess microbial community structure, composition and abundance and analyzed with a range of soil physico-chemical parameters. The results indicated significant rhizosphere effects in four out of the six sites, including areas with different levels of bird influence. Acidobacteria were significantly more abundant in soils with little bird influence (low nitrogen) and in bulk soil. In contrast, Actinobacteria were significantly more abundant in the rhizosphere of both plant species. At two of the sampling sites under strong bird influence (penguin colonies), Firmicutes were significantly more abundant in D. antarctica rhizosphere but not in C. quitensis rhizosphere. The Firmicutes were also positively and significantly correlated to the nitrogen concentrations in the soil. We conclude that the microbial communities in Antarctic soils are driven both by bird and plants, and that the effect is taxa-specific.

2012-06-01 | GSE33847 | GEO

Project description:16S High-throughput sequencing

| PRJNA984178 | ENA

Project description:16S high throughput sequencing

| PRJNA820991 | ENA

To explore the relationship between new gene expression / mutation and survival of patients in colorectal cancer

Project description:Interventions: Case vs control:No Primary outcome(s): High-throughput sequencing Study Design: Case-Control study

| 2676067 | ecrin-mdr-crc

Niche differentiation of arsenic-transforming microbial groups in rice rhizosphere compartments as impacted by water management and soil-As concentrations

Project description:Arsenic (As) bioavailability in the rice rhizosphere is influenced by many microbial interactions, particularly by metal-transforming functional groups at the root-soil interface. This study was conducted to examine As-transforming microbes and As-speciation in the rice rhizosphere compartments, in response to two different water management practices (continuous and intermittently flooded), established on fields with high to low soil-As concentration. Microbial functional gene composition in the rhizosphere and root-plaque compartments were characterized using the GeoChip 4.0 microarray. Arsenic speciation and concentrations were analyzed in the rhizosphere soil, root-plaque, porewater and grain samples. Results indicated that intermittent flooding significantly altered As-speciation in the rhizosphere, and reduced methyl-As and AsIII concentrations in the pore water, root-plaque and rice grain. Ordination and taxonomic analysis of detected gene-probes indicated that root-plaque and rhizosphere assembled significantly different metal-transforming functional groups. Taxonomic non-redundancy was evident, suggesting that As-reduction, -oxidation and -methylation processes were performed by different microbial groups. As-transformation was coupled to different biogeochemical cycling processes establishing functional non-redundancy of rice-rhizosphere microbiome in response to both rhizosphere compartmentalization and experimental treatments. This study confirmed diverse As-biotransformation at root-soil interface and provided novel insights on their responses to water management, which can be applied for mitigating As-bioavailability and accumulation in rice grains.

2021-07-12 | GSE179671 | GEO

Project description:High-throughput sequencing of chicken gut microbes

| PRJNA759544 | ENA

Hhigh-throughput sequencing of in vitro fecal fermentation samples

Project description:We report the use of high-throughput sequencing technology to detect the microbial composition and abundance of mice grastic contents before and after Helicobacter pylori infection or Lactobacillus paracasei ZFM54 pretreatment/treatment. The genomic DNA was obtained by the QIAamp PowerFecal DNA Kit. Then, the DNA samples were sent to BGI Genomics Co., Ltd. (Shenzhen, China) for V3-V4 region of the 16S rRNA gene high-throughput sequencing with an Illumina MiSeq platform. DNA samples were sequenced using primers 338F (forward primer sequence ACTCCTACGGGAGGCAGCAG)-806R (reverse primer sequence GGACTACHVGGGTWTCTAAT). The sequencing analyses were carried out using silva138/16s database as a reference for the assignation of Amplicon Sequence Variant (ASV) at 100% similarity.

2022-07-27 | GSE208665 | GEO

Project description:16s rRNA high-throughput sequencing

| PRJNA794205 | ENA