Ontology highlight
ABSTRACT:
PROVIDER: PRJNA904137 | ENA |
REPOSITORIES: ENA
Similar Datasets
Project description:Cell geometry is genetically inherited by all forms of life. In bacteria, shape is determined by the peptidoglycan and is nearly invariant during the metabolically active vegetative state. Essential morphogenetic complexes, the elongasome and divisome, expand the peptidoglycan along the major and minor axes, respectively, to generate a particular shape. Here, we provide evidence for the presence in Salmonella of two alternative elongasomes that generate a similar (rod) shape. One elongasome is directed by penicillin-binding protein 2 (PBP2) while the other is controlled by PBP2SAL, a pathogen-specific enzyme. In acidic niches, PBP2SAL replaces and renders dispensable PBP2. Our data also demonstrate distinct rates for the two identified elongasomes, with that directed by PBP2SAL exhibiting lower speed
2023-08-15 | PXD039436 | Pride
Project description:Cell shape plays a crucial role in microbial survival. While Haloferax volcanii, a model haloarchaeon, forms rods and disks, depending on environmental conditions, little is known about mechanisms underpinning archaeal cell-shape determination. We identified mutants that exclusively form rods and carried out comprehensive proteomics studies in which we compared these mutants to previously identified disk-only mutant strains and wild-type. Using this approach, we identified several additional candidates for shape determination. The generation of deletion mutants lacking genes encoding potential rod- and disk-determining factors, HVO_2174 (RdfA) and HVO_2176 (DdfA), respectively, resulted in rod- and disk-defective phenotypes. Comprehensive proteomics performed with ∆rdfA and ∆ddfA on these shape mutants implicated a diverse set of proteins, including transporters, signaling components, and transducers, as important for cell shape determination. We also identified structural proteins including the H. volcanii actin homolog volactin (VolA), a previously unknown cytoskeletal element, required for disk-shape morphogenesis.
2024-02-17 | PXD040781 | Pride
Project description:The SELEX-seq platform was used to generate DNA-binding affinity predictions for the human Max transcription factor. This experiment was performed as part of a cross-validation study comparing the accuracy of DNA shape-augmented TF binding specificity models across two different platforms (SELEX-seq and gcPBM)
2015-03-01 | GSE60200 | GEO
Project description:Pseudomonas aeruginosa undergoes cell elongation and forms robust biofilms during anaerobic respiratory growth using nitrate (NO3-) as an alternative electron acceptor. Understanding the mechanism of cell shape change induced upon anaerobiosis is crucial to the development of effective treatments against P. aeruginosa biofilm infection. Anaerobic growth of PAO1 reached higher cell density in the presence of vitamin B12, an essential coenzyme of class II ribonucleotide reductase. In addition, cell morphology returned to a normal rod shape. These results suggest that vitamin B12, the production of which was suppressed during anaerobic growth, can restore cellular machineries for DNA replication and therefore facilitate better anaerobic growth of P. aeruginosa with normal cell division. We used microarray to elucidate the global gene expression profiles underlying vitamin B12-induced changes in bacterial cell shape and growth-associated properties. Gene expression profiles of PAO1 grown in LBN (LB+NO3-) or LBN supplemented with 1 microM vitamin B12 are compared.
2012-06-17 | E-GEOD-34836 | biostudies-arrayexpress
Project description:Kinetochore localized Mad1 is essential for generating a “wait anaphase” signal during mitosis hereby ensuring accurate chromosome segregation. Inconsistent models for the function and quantitative contribution of the two mammalian Mad1 kinetochore receptors: Bub1 and the Rod-Zwilch-ZW10 (RZZ) complex exist. By combining genome editing and RNAi we achieve penetrant removal of Bub1 and Rod in human cells, which reveals that efficient checkpoint signaling depends on the integrated activities of these proteins. Rod removal reduces the proximity of Bub1 and Mad1 and we can bypass the requirement for Rod by tethering Mad1 to kinetochores or increasing the strength of the Bub1-Mad1 interaction. We find that Bub1 has checkpoint functions independent of Mad1 localization that are supported by low levels of Bub1 suggesting a catalytic function. In conclusion, our results support an integrated model for the Mad1 receptors in which the primary role of RZZ is to localize Mad1 at kinetochores to generate the Mad1-Bub1 complex.
2019-02-19 | PXD012235 | Pride
Project description:The SELEX-seq platform was used to generate DNA-binding affinity predictions for the human Max transcription factor. This experiment was performed as part of a cross-validation study comparing the accuracy of DNA shape-augmented TF binding specificity models across two different platforms (SELEX-seq and gcPBM) Two rounds of SELEX were performed on Max protein as described in Slattery et al, Cell, 2011 (PMID 22153072). Briefly, His-tagged Max was incubated with a randomized 16mer oligonucleotide library (GTTCAGAGTTCTACAGTCCGACGATCTGG[ACGT]{16}CCAGAACTCGTATGCCGTCTTCTGCTTG). Max bound DNA was amplified and sequenced as described (Slattery et al, 2011).
2015-03-01 | E-GEOD-60200 | biostudies-arrayexpress
Project description:The molecular pathogenesis of orbital lymphoproliferative disorders, such as immunoglobulin G4-related ophthalmic disease (IgG4-ROD) and orbital mucosa-associated lymphoid tissue (MALT) lymphoma, remains essentially unknown. Differentiation between the two disorders, which is important since work-up and treatment can vary greatly, is often challenging due to the lack of specific biomarkers. Although miRNAs play an important role in the regulation of carcinogenesis and inflammation, the relationship between miRNA and orbital lymphoproliferative diseases remains unknown. A comprehensive analysis of 2,565 miRNAs was performed in biopsied specimens and serum of 17 cases with IgG4-ROD and 21 cases with orbital MALT lymphoma. We identified specific miRNA signatures, their miRNA target pathways, and network analysis associated with IgG4-ROD and orbital MALT lymphoma. Machine-learning analysis identified miR-202-3p and miR-7112-3p as the best discriminators of IgG4-ROD and orbital MALT lymphoma, respectively. In the tissue pathway, Longevity regulating pathway in IgG4-ROD and MAPK signaling pathway in orbital MALT lymphoma were most enriched by downregulated miRNAs. This is the first evidence of the miRNA profile in biopsied specimens and serum of patients with IgG4-ROD and orbital MALT lymphoma. These data will be useful for developing diagnostic and therapeutic interventions, as well as elucidating of these disorders.
2021-08-01 | GSE155177 | GEO
Project description:Pseudomonas aeruginosa undergoes cell elongation and forms robust biofilms during anaerobic respiratory growth using nitrate (NO3-) as an alternative electron acceptor. Understanding the mechanism of cell shape change induced upon anaerobiosis is crucial to the development of effective treatments against P. aeruginosa biofilm infection. Anaerobic growth of PAO1 reached higher cell density in the presence of vitamin B12, an essential coenzyme of class II ribonucleotide reductase. In addition, cell morphology returned to a normal rod shape. These results suggest that vitamin B12, the production of which was suppressed during anaerobic growth, can restore cellular machineries for DNA replication and therefore facilitate better anaerobic growth of P. aeruginosa with normal cell division. We used microarray to elucidate the global gene expression profiles underlying vitamin B12-induced changes in bacterial cell shape and growth-associated properties.
2012-06-18 | GSE34836 | GEO
Project description:While dysfunction and/or death of light-detecting photoreceptor cells underlies most inherited retinal dystrophies, knowledge of the species-specific details of human rod and cone photoreceptor cell development remains limited. Here, we generate retinal organoids using induced pluripotent stem cells (iPSC) derived from a patient with genetic photoreceptor disease, an isogenic control, and an unrelated control. Organoids were sampled using single-cell RNA sequencing across the developmental window encompassing photoreceptor specification, emergence, and maturation; up to 260 days of in vitro differentiation. Using single-cell transcriptomics data, we reconstruct the rod photoreceptor developmental lineage and identify a branchpoint in development unique to the disease state that gives rise to a divergent rod photoreceptor cell population. We show that the rod-specific transcription factor NR2E3 is required for the proper expression of genes involved in phototransduction, including expression of the light-sensitive protein rhodopsin, which is absent in divergent rods. NR2E3-null rods additionally misexpress several cone-specific phototransduction genes at both the transcript and protein level. Using joint multimodal single-cell sequencing on late-stage retinal organoids, we further identify the specific putative regulatory sites where rod-specific factors act to steer rod and cone photoreceptor cell development. Importantly, these findings are strikingly different than that observed in rodent models of disease. Together, these data provide a roadmap of human photoreceptor development and leverage patient iPSCs to define the specific roles of rod transcription factors in photoreceptor cell emergence and maturation.
2024-04-01 | GSE236197 | GEO
Project description:Retinal Müller glia (MG) can act as stem-like cells to generate new neurons in both zebrafish in mice. In zebrafish, retinal regeneration is innate and robust, resulting in the replacement of lost neurons and restoration of visual function. In mice, exogenous stimulation of MG is required to reveal a dormant and, to date, limited regenerative capacity. Zebrafish studies have been key in revealing factors that promote regenerative responses in the mammalian eye. Increased understanding of how the regenerative potential of MG is regulated in zebrafish may therefore aid efforts to promote retinal repair therapeutically. Developmental signaling pathways are known to coordinate regeneration following widespread retinal cell loss. In contrast, less is known about how regeneration is regulated in the context of retinal degenerative disease, i.e., following the loss of specific retinal cell types. To address this knowledge gap, we compared transcriptomic changes between two selective cell ablation paradigms, targeted loss of rod photoreceptors or bipolar cells. Our study spanned twelve time points encompassing the entire degenerative and regenerative process of each targeted cell type. 2,531 differentially expressed genes (DEGs) were identified. Interestingly, the majority of DEGs were paradigm specific, including during MG activation phases, suggesting the nature of the injury/cell loss informs the regenerative process from initiation onward. For example, early modulation of Notch signaling was implicated in the rod but not bipolar cell ablation paradigm. Components of JAK/STAT signaling were activated in both paradigms but were more strongly induced during rod cell regeneration. We functionally validated the role of JAK/STAT signaling during rod cell regeneration using CRISPR/Cas9-based knockdown of stat3 which inhibited both MG proliferation and rod cell regeneration kinetics. Additionally, although more than a third of all DEGs are implicated as immune-system regulators, individual immune-related factors were largely paradigm specific. These data support emerging evidence that discrete “fate-biased” regenerative processes follow from selective retinal cell loss. Microarrays were used to follow gene expression changes in the eyes of fish following either rod or bipolar specific induced death.
2023-06-13 | GSE234646 | GEO