Ontology highlight
ABSTRACT:
PROVIDER: PRJNA940448 | ENA |
REPOSITORIES: ENA
Dataset's files
| Action | DRS | |||
|---|---|---|---|---|
| SRR23886273.fastq.gz | Fastqsanger.gz | |||
| SRR23886274.fastq.gz | Fastqsanger.gz | |||
| SRR23886275.fastq.gz | Fastqsanger.gz | |||
| SRR23886276.fastq.gz | Fastqsanger.gz | |||
| SRR23886277.fastq.gz | Fastqsanger.gz |
Items per page: 5 1 - 5 of 9 |
Similar Datasets
Project description:Astrocytes drive divergent metabolic gene expression in humans and chimpanzees
| PRJNA665853 | ENA
Project description:We compared the genome-wide patterns of DNA methylation in the brains of humans to those of our closest evolutionary relative, chimpanzees, using base-pair resolution whole-genome methylation maps of the prefrontal cortex. Our data reveal that the prefrontal cortex is the most heavily methylated among the human tissues examined so far. Nevertheless, hundreds of genes exhibit dramatically reduced levels of promoter DNA methylation in the human brain relative to the chimpanzee brain. Many of these genes are associated with neurological disorders, psychological disorders, and cancers, and are enriched for functions related to cellular metabolic processes and protein binding. Moreover, the majority of these genes exhibit higher expression in the human brain compared to the chimpanzee brain. Profiling DNA methylation map in prefrontal cortex regions of postmortem brains of three humans and three chimpanzees
2012-09-04 | E-GEOD-37202 | biostudies-arrayexpress
Project description:This dataset was generated with the goal of comparative study of gene expression in three brain regions and two non-neural tissues of humans, chimpanzees, macaque monkeys and mice. Using this dataset, we performed studies of gene expression and gene splicing evolution across species and search of tissue-specific gene expression and splicing patterns. We also used the gene expression information of genes encoding metabolic enzymes in this dataset to support a larger comparative study of metabolome evolution in the same set of tissues and species. 120 tissue samples of prefrontal cortex (PFC), primary visual cortex (VC), cerebellar cortex (CBC), kidney and skeletal muscle of humans, chimpanzees, macaques and mice. The data accompanies a large set of metabolite measurements of the same tissue samples. Enzyme expression was used to validate metabolite measurement variation among species.
2014-05-30 | E-GEOD-49379 | biostudies-arrayexpress
Project description:Human neocortex expansion likely contributed to the remarkable cognitive abilities of humans. This expansion is thought to primarily reflect differences in proliferation versus differentiation of neural progenitors during cortical development. Here, we have searched for such differences by analysing cerebral organoids from human and chimpanzees using immunohistochemistry, live imaging, and single-cell transcriptomics. We find that the cytoarchitecture, cell type composition, and neurogenic gene expression programs of humans and chimpanzees are remarkably similar. Notably, however, live imaging of apical progenitor mitosis uncovered a lengthening of prometaphase-metaphase in humans compared to chimpanzees that is specific to proliferating progenitors and not observed in non-neural cells. Consistent with this, the small set of genes more highly expressed in human apical progenitors points to increased proliferative capacity, and the proportion of neurogenic basal progenitors is lower in humans. These subtle differences in cortical progenitors between humans and chimpanzees may have consequences for human neocortex evolution.
2016-11-04 | GSE86207 | GEO
Project description:We used embryoid bodies to compare differences in gene expression between humans and chimpanzees in a large number of cell types
2023-04-11 | GSE201516 | GEO
Project description:Inter-individual variation in gene regulation has been shown to be heritable and it is quite often associated with differences in disease susceptibility between individuals. While many human studies focused on mapping associations between genetic and gene regulatory variation, much less attention has been paid to the evolutionary processes that shape the observed differences in gene regulation between individuals in humans or any other primate. To begin addressing this gap, we performed a comparative expression quantitative trait loci (eQTL) mapping study in humans and chimpanzees, using gene expression data from primary heart samples. While expression variability in both species is strongly determined by non-genetic sources, such as cell type heterogeneity, we found evidence that the degree of inter-individual variation in gene regulation is generally conserved in humans and chimpanzees. In particular, we found a significant overlap of genes associated with eQTLs in the two species. We conclude that humans and chimpanzees share sources common determinants of gene expression variability, including genetically regulated constraints from stabilizing and diversifying selection pressures.
2020-05-29 | GSE151397 | GEO
Project description:Despite the close evolutionary relationship and striking genetic similarity between humans and chimpanzees, there are remarkable differences in anatomy, behavior, and disease susceptibility in the two species. One step towards understanding the biological basis of these phenotypic differences is to characterize quantitative differences in levels of expression of genes in humans and chimpanzees. To contribute to such analysis, we compared gene expression patterns in lymphoblastoid cell lines between nine unrelated humans and ten unrelated chimpanzees by using human cDNA microarrays. Hybridizations to arrays containing 43,233 features produced high quality data for 22,879 cDNA clones, representing 20,266 Unigenes. We observed statistically significant differences in transcript levels for 32% of these genes (P < 0.05, Student t test), with about 200 cDNAs showing differences of more than 2-fold (lower bounds of 95% confidence interval). Among these are genes involved in cell surface glycosylation and responses to toxins and viruses. Examination of functional annotations for the differentially expressed genes revealed lower expression of cell cycle and energy pathways genes, and higher expression of chemokines, 26S proteasome and cell motility genes in chimpanzee samples. These genes and pathways could underlie some of the phenotypic differences between humans and chimpanzees. Keywords: other
2005-06-08 | GSE1464 | GEO
Project description:This dataset was generated with the goal of comparative study of gene expression in three brain regions and two non-neural tissues of humans, chimpanzees, macaque monkeys and mice. Using this dataset, we performed studies of gene expression and gene splicing evolution across species and search of tissue-specific gene expression and splicing patterns. We also used the gene expression information of genes encoding metabolic enzymes in this dataset to support a larger comparative study of metabolome evolution in the same set of tissues and species.
2014-05-30 | GSE49379 | GEO
Project description:Gene regulatory divergence is thought to play a central role in determining human-specific traits. However, our ability to link divergent regulation to divergent phenotypes is limited. Here, we utilized human-chimpanzee hybrid induced pluripotent stem cells to study divergent gene expression separating these species. The hybrid cells allowed us to separate cis- from trans-regulatory effects, and to control for non-genetic factors that often confound comparative studies. We differentiated these cells into cranial neural crest cells (CNCCs), the primary cell type giving rise to the face, and used the hybrid cells to generate a catalogue of divergent cis-regulatory gene expression between humans and chimpanzees. We found that cis-regulatory divergence is tightly linked to phenotypic divergence, enabling the identification of candidate genes associated with several divergent traits. Specifically, we find support for lineage-specific selection acting on the cis-regulation of the hedgehog signaling pathway. This pathway includes EVC2 (LIMBIN), whose cis-regulation is among the most divergent in the genome, resulting in 6-fold down-regulation along the human lineage. We found that inducing a similar reduction in EVC2 levels substantially reduces Hh signaling output. Mice and humans lacking functional EVC2 show striking parallels to many human-chimpanzee phenotypic differences, particularly in the skull and face, suggesting that the regulatory divergence of Hh signaling may have contributed to the unique craniofacial morphology of humans. In sum, our results suggest that human-chimpanzee hybrid cells can serve as a valuable resource to study the evolution of gene regulation and its impact on phenotypic divergence. SRA/fastq files include Illumina adapters (GATCGGAAGAGCACACGTCT and GATCGGAAGAGCGTCGTGTA).
2020-10-09 | GSE146481 | GEO