Ontology highlight
ABSTRACT:
PROVIDER: PRJNA940438 | ENA |
REPOSITORIES: ENA
Dataset's files
| Action | DRS | |||
|---|---|---|---|---|
| SRR23913700.fastq.gz | Fastqsanger.gz | |||
| SRR23913701.fastq.gz | Fastqsanger.gz | |||
| SRR23913702.fastq.gz | Fastqsanger.gz | |||
| SRR23913694.fastq.gz | Fastqsanger.gz | |||
| SRR23913695.fastq.gz | Fastqsanger.gz |
Items per page: 5 1 - 5 of 9 |
Similar Datasets
Project description:Astrocytes drive divergent metabolic gene expression in humans and chimpanzees
| PRJNA665853 | ENA
Project description:Amyotrophic lateral sclerosis (ALS) is a progressive neurodegenerative disease whose pathophysiology is largely unknown. Despite motor neuron death is recognized as the key event in ALS, astrocytes dysfunctionalities and neuroinflammation were demonstrated to accompany and probably even drive motor neuron loss. Nevertheless, the mechanisms priming astrocyte failure and hyperactivation are still obscure. In this work, altered pathways in ALS astrocytes were unveiled by investigating the proteomic profile of primary spinal-cord astrocytes derived from transgenic ALS mouse model overexpressing the human (h)SOD1(G93A) protein, in comparison with the transgenic counterpart expressing hSOD1(WT) protein. In this research, we showed that hSOD1(G93A) astrocytes present a profound alterations in the expression of proteins involved in proteostasis and glutathione metabolism.
2022-02-17 | PXD026576 | Pride
Project description:Inflammatory cytokine responses to activation of innate immunity differ between individuals, yet the genomic and transcriptomic determinants of inflammatory responsiveness are not well understood. We hypothesized that mRNA and lincRNA expression is modulated in disease-relevant tissues in humans in vivo during inflammation, and differs between individuals with divergent evoked inflammatory responses. In the Genetics of Evoked Response to Niacin and Endotoxemia (GENE) Study, we performed an inpatient endotoxin challenge (1ng/kg LPS) in healthy humans. We selected individuals in the top (high-responders) and bottom (low-responders) extremes for inflammatory responses, and applied RNASeq to peripheral blood mononuclear cells (PBMC, n=15) before and after LPS administration. At baseline, there were limited differences in gene expression by sex or race. Further, only a small number of genes differed between high and low responders at baseline. Post-LPS, there were clear differences in the magnitude of the transcriptional response between high and low responders, with a far greater number of genes differentially expressed post-LPS in high responders, consistent with the clinical response. We also found a number of differentially expressed long intergenic non-coding RNAs (lincRNAs) post-LPS. We show that differences in gene expression may drive differences in clinical inflammatory response, and that differentially expressed genes and lincRNAs represent novel candidates for modulation of immune and metabolic responses in acute and chronic diseases.
2016-09-27 | GSE87290 | GEO
Project description:Cohesin loop extrusion facilitates precise gene expression by continuously driving promoters to sample all enhancers located within the same topologically-associated domain (TAD). However, many TADs contain multiple genes with divergent expression patterns, thereby indicating additional forces further refine how enhancer activities are utilised. Here, we unravel the mechanisms enabling a new gene, Rex1, to emerge with divergent expression within the ancient Fat1 TAD in placental mammals. We show that such divergent expression is not determined by a strict enhancer-promoter compatibility code, intra-TAD position or nuclear envelope-attachment. Instead, TAD-restructuring in embryonic stem cells (ESCs) separates Rex1 and Fat1 with distinct proximal enhancers that independently drive their expression. By contrast, in later embryonic tissues, DNA methylation renders the inactive Rex1 promoter profoundly unresponsive to Fat1 enhancers within the intact TAD. Combined, these features adapted an ancient regulatory landscape during evolution to support two entirely independent Rex1 and Fat1 expression programs. Thus, rather than operating only as rigid blocks of co-regulated genes, TAD-regulatory landscapes can orchestrate complex divergent expression patterns in evolution.
2022-09-29 | GSE185772 | GEO
Project description:Cohesin loop extrusion facilitates precise gene expression by continuously driving promoters to sample all enhancers located within the same topologically-associated domain (TAD). However, many TADs contain multiple genes with divergent expression patterns, thereby indicating additional forces further refine how enhancer activities are utilised. Here, we unravel the mechanisms enabling a new gene, Rex1, to emerge with divergent expression within the ancient Fat1 TAD in placental mammals. We show that such divergent expression is not determined by a strict enhancer-promoter compatibility code, intra-TAD position or nuclear envelope-attachment. Instead, TAD-restructuring in embryonic stem cells (ESCs) separates Rex1 and Fat1 with distinct proximal enhancers that independently drive their expression. By contrast, in later embryonic tissues, DNA methylation renders the inactive Rex1 promoter profoundly unresponsive to Fat1 enhancers within the intact TAD. Combined, these features adapted an ancient regulatory landscape during evolution to support two entirely independent Rex1 and Fat1 expression programs. Thus, rather than operating only as rigid blocks of co-regulated genes, TAD-regulatory landscapes can orchestrate complex divergent expression patterns in evolution.
2022-09-29 | GSE185771 | GEO
Project description:Cohesin loop extrusion facilitates precise gene expression by continuously driving promoters to sample all enhancers located within the same topologically-associated domain (TAD). However, many TADs contain multiple genes with divergent expression patterns, thereby indicating additional forces further refine how enhancer activities are utilised. Here, we unravel the mechanisms enabling a new gene, Rex1, to emerge with divergent expression within the ancient Fat1 TAD in placental mammals. We show that such divergent expression is not determined by a strict enhancer-promoter compatibility code, intra-TAD position or nuclear envelope-attachment. Instead, TAD-restructuring in embryonic stem cells (ESCs) separates Rex1 and Fat1 with distinct proximal enhancers that independently drive their expression. By contrast, in later embryonic tissues, DNA methylation renders the inactive Rex1 promoter profoundly unresponsive to Fat1 enhancers within the intact TAD. Combined, these features adapted an ancient regulatory landscape during evolution to support two entirely independent Rex1 and Fat1 expression programs. Thus, rather than operating only as rigid blocks of co-regulated genes, TAD-regulatory landscapes can orchestrate complex divergent expression patterns in evolution.
2022-09-29 | GSE185774 | GEO
Project description:RNA-Seq experiment to detect transcriptional differences in iPSC derived astrocytes between 3 primate species, humans, chimpanzees and macaques. The goal of the experiment is to characterise genome-wide evolutionary changes in transcriptional and regulatory systems across the primate lineage in astrocytes
2025-03-06 | E-MTAB-13252 | biostudies-arrayexpress
Project description:Gene regulatory divergence is thought to play a central role in determining human-specific traits. However, our ability to link divergent regulation to divergent phenotypes is limited. Here, we utilized human-chimpanzee hybrid induced pluripotent stem cells to study divergent gene expression separating these species. The hybrid cells allowed us to separate cis- from trans-regulatory effects, and to control for non-genetic factors that often confound comparative studies. We differentiated these cells into cranial neural crest cells (CNCCs), the primary cell type giving rise to the face, and used the hybrid cells to generate a catalogue of divergent cis-regulatory gene expression between humans and chimpanzees. We found that cis-regulatory divergence is tightly linked to phenotypic divergence, enabling the identification of candidate genes associated with several divergent traits. Specifically, we find support for lineage-specific selection acting on the cis-regulation of the hedgehog signaling pathway. This pathway includes EVC2 (LIMBIN), whose cis-regulation is among the most divergent in the genome, resulting in 6-fold down-regulation along the human lineage. We found that inducing a similar reduction in EVC2 levels substantially reduces Hh signaling output. Mice and humans lacking functional EVC2 show striking parallels to many human-chimpanzee phenotypic differences, particularly in the skull and face, suggesting that the regulatory divergence of Hh signaling may have contributed to the unique craniofacial morphology of humans. In sum, our results suggest that human-chimpanzee hybrid cells can serve as a valuable resource to study the evolution of gene regulation and its impact on phenotypic divergence. SRA/fastq files include Illumina adapters (GATCGGAAGAGCACACGTCT and GATCGGAAGAGCGTCGTGTA).
2020-10-09 | GSE146481 | GEO
Project description:Epigenetic dysregulation is a universal feature of cancer that results in altered patterns of gene expression that drive malignancy. Brain tumors exhibit subtype-specific epigenetic alterations, however the molecular mechanisms responsible for these diverse epigenetic states remain unclear. Here we show that the developmental transcription factor Sox9 differentially regulates epigenomic states in high-grade glioma (HGG) and ependymoma (EPN). These contrasting roles for Sox9 correspond with protein interactions with histone deacetylating complexes in HGG, and association with the Rela oncofusion in EPN. Together, our studies demonstrate how epigenomic states are differentially regulated in distinct subtypes of brain tumors, while revealing divergent roles for Sox9 in HGG and EPN tumorigenesis.
2022-07-13 | PXD033863 | Pride