Browse
Submit Data
Databases
API
Help

Dataset Information

0 Views

0 Connections

0 Citations

0 Reanalyses

0 Downloads

Omics score: 0

ABSTRACT: Maize root mucilage microbiome using Illumina v4-MiSeq sequencing

PROVIDER: PRJNA964762 | ENA |

REPOSITORIES: ENA

ACCESS DATA

Json Xml

Dataset's files

Source:

			Action	DRS
	SRR24377047_1.fastq.gz	Fastqsanger.gz
	SRR24377047_2.fastq.gz	Fastqsanger.gz
	SRR24377048_1.fastq.gz	Fastqsanger.gz
	SRR24377048_2.fastq.gz	Fastqsanger.gz
	SRR24377049_1.fastq.gz	Fastqsanger.gz

Items per page:

1 - 5 of 48

Similar Datasets

Project description:Maize root mucilage-associated microbiome using PacBio SMRT Sequel II sequencing technology

| PRJNA964596 | ENA

Molecular changes in the maize roots transcriptome due to soil microbes

Project description:The association between soil microbes and plant roots is present in all natural and agricultural environments. Microbes can be beneficial, pathogenic, or neutral to the host plant development and adaptation to abiotic or biotic stresses. Progress in investigating the functions and changes in microbial communities in diverse environments have been rapidly developing in recent years, but the changes in root function is still largely understudied. The aim of this study was to determine how soil bacteria influence maize root transcription and microRNAs (miRNAs) populations in a controlled inoculation of known microbes over a defined time course. At each time point after inoculation of the maize inbred line B73 with ten bacterial isolates, DNA and RNA were isolated from roots. The V4 region of the 16S rRNA gene was amplified from the DNA and sequenced with the Illumina MiSeq platform. Amplicon sequencing of the 16S rRNA gene indicated that most of the microbes successfully colonized maize roots. The colonization was dynamic over time and varied with the specific bacterial isolate. Small RNA sequencing and mRNA-Seq was done to capture changes in the root transcriptome from 0.5 to 480 hours after inoculation. The transcriptome and small RNA analyses revealed epigenetic and transcriptional changes in roots due to the microbial inoculation. This research provides the foundational data needed to understand how plant roots interact with bacterial partners and will be used to develop predictive models for root response to bacteria.

2023-05-01 | GSE214656 | GEO

Evaluating the gut microbiota shifts caused by two diets based on ancient grains

Project description:Total DNA was extracted from stool specimens, amplified to collect amplicons of variable V3–V4 regions of the bacterial 16s rRNA gene and sequenced with MiSeq (2x300bp) Illumina platform.

2022-08-24 | GSE206807 | GEO

Comparing the microbiota composition between Cocaine addicted and Healthy subjects and the corresponding shift caused by rTMS treatment.

Project description:Total DNA was extracted from saliva and stool of the patients, amplified to collect amplicons of variable V3–V4 regions of the bacterial 16s rRNA gene and sequenced with MiSeq (2x300bp) Illumina platform.

2023-05-31 | GSE206765 | GEO

Analysis of microbiota composition within breast tumor and healthy breast tissues in males and females

Project description:Total DNA was extracted from FFPE specimens of breast tumor and surrounding healthy tissue, amplified to collect amplicons of variable V3–V4 regions of the bacterial 16s rRNA gene and sequenced with MiSeq (2x300bp) Illumina platform.

2023-06-14 | GSE212891 | GEO

Comparing the microbiota composition between HPV positive and negative patients with CRC

Project description:Total DNA was extracted from the stool of the patients, amplified to collect amplicons of variable V3–V4 regions (primers 341F and 805R) of the bacterial 16s rRNA gene and sequenced with MiSeq (2x300bp) Illumina platform.

2023-10-15 | GSE216589 | GEO

Microbial community composition in anaerobic digesters fed low and high concentrations of acetate

Project description:Using Illumina MiSeq platform for amplicon sequencing of 16S rRNA V4 region

| PRJEB10871 | ENA

Epigenetic modifications and their relationships to smRNA and mRNA transcriptomes in maize

Project description:Genome-wide and organ-specific landscapes of epigenetic modifications and their relationships to mRNA and smRNA transcriptomes in maize We report an integrated genome-wide analysis of DNA methylation, histone modifications, smRNAs and mRNA transcriptional activity, using maize as a model. We surveyed the epigenomes of the maize inbred line B73 in shoot and root tissue by Illumina/Solexa 1G parallel sequencing after digesting genomic DNA with a methylation-sensitive restriction enzyme and after conducting chromatin immunoprecipitations (ChIP) using antibodies that target specific histone modifications (H3K4me3, H3K9ac, H3K27me3, H3K36me3, respectively). Additionally, we profiled RNA pools (micro RNA (miRNA), siRNA and mRNA) using the same sequencing strategy. Keywords: Epigenetics, mRNA transcription and small RNAs

2009-04-28 | GSE15286 | GEO

Maize root bacteria degrade host-specialized metabolites through the lactonase BxdA

Project description:Root exudates contain specialised metabolites that affect the plant’s root microbiome. How host-specific microbes cope with these bioactive compounds, and how this ability shapes root microbiomes, remains largely unknown. We investigated how maize root bacteria metabolise benzoxazinoids, the main specialised metabolites of maize. Diverse and abundant bacteria metabolised the major compound in the maize rhizosphere MBOA and formed AMPO. AMPO forming bacteria are enriched in the rhizosphere of benzoxazinoid-producing maize and can use MBOA as carbon source. We identified a novel gene cluster associated with AMPO formation in microbacteria. The first gene in this cluster, bxdA encodes a lactonase that converts MBOA to AMPO in vitro. A deletion mutant of the homologous bxdA genes in the genus Sphingobium, does not form AMPO nor is it able to use MBOA as a carbon source. BxdA was identified in different genera of maize root bacteria. Here we show that plant-specialised metabolites select for metabolisation-competent root bacteria. BxdA represents a novel benzoxazinoid metabolisation gene whose carriers successfully colonize the maize rhizosphere and thereby shape the plant’s chemical environmental footprint

2024-04-05 | GSE263275 | GEO

Hhigh-throughput sequencing of in vitro fecal fermentation samples

Project description:We report the use of high-throughput sequencing technology to detect the microbial composition and abundance of mice grastic contents before and after Helicobacter pylori infection or Lactobacillus paracasei ZFM54 pretreatment/treatment. The genomic DNA was obtained by the QIAamp PowerFecal DNA Kit. Then, the DNA samples were sent to BGI Genomics Co., Ltd. (Shenzhen, China) for V3-V4 region of the 16S rRNA gene high-throughput sequencing with an Illumina MiSeq platform. DNA samples were sequenced using primers 338F (forward primer sequence ACTCCTACGGGAGGCAGCAG)-806R (reverse primer sequence GGACTACHVGGGTWTCTAAT). The sequencing analyses were carried out using silva138/16s database as a reference for the assignation of Amplicon Sequence Variant (ASV) at 100% similarity.

2022-07-27 | GSE208665 | GEO

OmicsDI is part of the ELIXIR infrastructure

OmicsDI is an Elixir interoperability service. Learn more ›

Tweets

OmicsDI Databases

PRIDE
PeptideAtlas
MassIVE
JPOST Repository
Physiome Model Repository

EGA
EVA
ENA
LINCS
PAXDB
Cell Collective

MetaboLights
Metabolomics Workbench
MetabolomeExpress
GNPS
BioModels
FAIRDOMHub

ArrayExpress
dbGaP
ExpressionAtlas
GEO
NODE

Information

Databases
Help
API
Contact us
Code on GitHub
Terms of use
Submit Data