Browse
Submit Data
Databases
API
Help

Dataset Information

0 Views

0 Connections

0 Citations

0 Reanalyses

0 Downloads

Omics score: 0

Expression profiling of STAT3-regulated genes in U937-derived macrophages

ABSTRACT: Expression profiling of STAT3-regulated genes in U937-derived macrophages

PROVIDER: PRJNA967991 | ENA |

REPOSITORIES: ENA

ACCESS DATA

Json Xml

Dataset's files

Source:

			Action	DRS
	SRR24457630_1.fastq.gz	Fastqsanger.gz
	SRR24457630_2.fastq.gz	Fastqsanger.gz
	SRR24457631_1.fastq.gz	Fastqsanger.gz
	SRR24457631_2.fastq.gz	Fastqsanger.gz
	SRR24457632_1.fastq.gz	Fastqsanger.gz

Items per page:

1 - 5 of 12

Similar Datasets

Expression profiling of STAT3-regulated genes in U937-derived macrophages

Project description:We used RNA-Seq assay to characterize STAT3-regulated gene expression patterns in U937-derived macrophages. We wanted to determine how STAT3 activation involves in function, differentiation, cytokine secretion of macrophages.

2023-10-26 | GSE231829 | GEO

Differential gene expression between uninfected and infected U937 derived macrophages with Leishmania braziliensis

Project description:The main objective of this study is to identify the list of genes differentially expressed between infected with Leishmania braziliensis and non-infected macrophage cultures based on gene expression microarray profiling The dataset is comprised by the expression profile of 6 samples from three independent experiments and each experiment had three technical replicates. 3 of the 6 samples were U937 derived macrophages infected by Leishmania braziliensis and the other 3 were U937 derived macrophages without infection with Leishmania braziliensis. A total of 18 microarrays analysis were performed.

2015-06-10 | E-GEOD-61211 | biostudies-arrayexpress

Genes regulated by AML1/ETO in U937 cells

2008-11-28 | GSE10520 | GEO

ChIP-seq analysis of H3[delta]N genomic localization in U937 cells, primary monocytes, and monocyte-derived macrophages

Project description:ChIP-seq analysis reveals widespread H3[delta]N distribution across the genome in U937 cells, and primary monocytes, which is largely absent in fully differentiated macrophages.

2021-04-01 | GSE142661 | GEO

Genome-wide binding of STAT3 in peritoneal macrophages

Project description:To try to identify the mechanism of STAT3âs indirect action we have used a genomic approach to map the binding sites of STAT3 within the genome and also used RNA-seq technology to map the changes in RNA expression and transcript isoforms in response to IL-10. Examination of STAT3 binding by ChIP-seq in Unstimulated and IL-10 treated peritoneal exudate macrophages purified from mice. We sequenced anti-STAT3 ChIP-seq as well as corresponding control (Input) libraries

2012-02-13 | E-GEOD-31529 | biostudies-arrayexpress

Genes regulated after knock-down of Pirin in U937 cells

Project description:Pirin (PIR) is a putative transcriptional regulator whose expression is silenced in cells bearing the AML1/ETO and PML/RAR leukemogenic fusion proteins and is significantly repressed in a large proportion of acute myeloid leukemias. PIR expression increases during in vitro myeloid differentiation of primary hematopoietic precursor cells, and ablation of PIR in the U937 myelomonocytic cell line or in murine primary hematopoietic precursor cells results in impairment of terminal myeloid differentiation. Keywords: Transcriptional regulation, knock-down using shRNA We analyzed gene expression profiles of U937 cells after knock-down of PIR using the shPIR#7 oligonucleotides cloned in the pSICO-R lentiviral vector. No residual PIR protein is detectable in U937-shPIR#7 cells by Western blotting. U937 cells containing the empty cloning vector (U937-pSICO) were used as control. shPIR#7 oligonucleotide sequences: Human PIR#7-for: TGAAGCCACTTTGTCTTAATTTCAAGAGAATTAAGACAAAGTGGCTTCTTTTTTC Human PIR#7-rev: TCGAGAAAAAAGAAGCCACTTTGTCTTAATTCTCTTGAAATTAAGACAAAGTGGCTTCA For each sample, an RNA pool was obtained by mixing equal quantities of total RNA from each of three independent RNA extractions. Each biotin-labeled target was hybridized to two GeneChip HG-U133 Plus v.2 arrays.

2009-12-10 | E-GEOD-16798 | biostudies-arrayexpress

Identification of latent tuberculosis infection-related microRNAs in human U937 macrophages expressing Mycobacterium tuberculosis Hsp16.3

Project description:Latent tuberculosis infection (LTBI) relies on a homeostasis of macrophages and Mycobacterium tuberculosis (Mtb). The small heat shock protein, Mtb Hsp16.3 (also known as latency-associated antigen), plays an important role in Mtb persistence within macrophages. However, the mechanism of LTBI remains elusive. The aim of this study was to delineate LTBI-related miRNA expression in U937 macrophages expressing Mtb Hsp16.3 protein. This study intends to explore the potential function of miRNAs in the interaction of macrophages with Mtb Hsp16.3 and provide insights for investigating the role of macrophage homeostasis in LTBI. U937 macrophages were infected with an integrase-deficient Lentivirus vector to transiently express Mtb Hsp16.3, and green fluorescent protein (GFP) as a control. We used a microRNA (miRNA) microarray chip containing more than 1000 probes to identify the significant differentially expressed miRNAs in the infected U937 cells, and employed real-time quantitative polymerase chain reaction (qRT-PCR) for validation. Furthermore, we confirmed these candidate LTBI-related miRNAs in peripheral blood mononuclear cells from subjects with LTBI and in healthy control individuals. Functional annotation prediction of miRNA target genes and pathway enrichment analyses were used to explore the putative links between these miRNAs and LTBI.

2014-03-17 | E-GEOD-54630 | biostudies-arrayexpress

Gene expression Data from Toxoplasma gondii-Infected Murine Bone Marrow-Derived STAT6 and STAT3 Deficient Macrophages

Project description:The Toxoplasma type I ROP16 kinase directly activates the host STAT3 and STAT6 transcription factors and regulates the expression of many host genes. However, many of genes lack known STAT3/6 transcription factor binding sites in their promoter regions. We wanted to understand what fraction of host genes that are modulated by ROP16 were dependent on the STAT3 and STAT6 signaling pathways. Bone marrow-derived macrophages (BMMs) from mLys-Mcre Stat3fl/fl mice were infected with type II (Pru A7), type II +ROP16 I, type II Δgra15, or type II Δgra15 + ROP16I and gene expression was analyzed 18 hrs after infection. This data set was generated side by side with infections performed in B6 BMDMs, the gene expression results for that experiment were previoiusly submitted under the GEO accession number GSE29404. In addition, gene expression of wild type B6 and Stat6-/- BMDMs were infected with the II+ROP16I strain.

2013-03-20 | E-GEOD-45309 | biostudies-arrayexpress

Identification of genes responsive to ultrasound in human leukemia U937 cells

Project description:Here, the effects of non-thermal low intensity pulsed ultrasound (LIPUS) on the gene expression in human lymphoma U937 cells were investigated using by an Affymetrix GeneChip system. Six hours after LIPUS treatment (0.3 W/cm2 for 1 min), apoptosis (14±3.8%, mean±SD) with minimal cell lysis was observed. At 3 h post-treatment, LIPUS down-regulated 193 genes and up-regulated 201 genes by >1.5-fold. Keywords: ultrasound, gene expression, Human lymphoma U937 cell

2008-01-23 | GSE10212 | GEO

Transcription profiling of human U937 cells expressing AML1/ETO compared to vector transfected U937 cells to identify genes regulated by AML1/ETO

Project description:Approximately 20% of Acute Myelogenous Leukemia (AML) cases carry the t(8;21) translocation, which involves the AML1 and ETO genes, and express the resulting AML1/ETO fusion protein that functions as a transcriptional repressor by recruiting NCoR/SMRT/HDAC complexes to DNA. We used microarrays to identify genes differentially expressed in U937 cells expressing AML1/ETO compared to vector transfected U937 cells. Experiment Overall Design: A U937 cell line that conditionally expresses HA-tagged AML1/ETO under the control of the mouse metallothionine promoter (U937-A1E) (Alcalay et al., J.Clin.Invest, 2003,112, 1751-1761) was used. A cell line caryying the empty vector was used as control Cells were treated for 8h with 100uM ZnSO4 to induce transgene expression. For each of the U937 cell lines (AML1/ETO and Mt), three independent RNA extractions were performed, and an equal quantity of each of the three RNA preparations was then mixed to generate an RNA pool for each sample.

2009-01-13 | E-GEOD-10520 | biostudies-arrayexpress

OmicsDI is part of the ELIXIR infrastructure

OmicsDI is an Elixir interoperability service. Learn more ›

Tweets

OmicsDI Databases

PRIDE
PeptideAtlas
MassIVE
JPOST Repository
Physiome Model Repository

EGA
EVA
ENA
LINCS
PAXDB
Cell Collective

MetaboLights
Metabolomics Workbench
MetabolomeExpress
GNPS
BioModels
FAIRDOMHub

ArrayExpress
dbGaP
ExpressionAtlas
GEO
NODE

Information

Databases
Help
API
Contact us
Code on GitHub
Terms of use
Submit Data