Unknown,Transcriptomics,Genomics,Proteomics

Dataset Information

Genes regulated after knock-down of Pirin in U937 cells

ABSTRACT: Pirin (PIR) is a putative transcriptional regulator whose expression is silenced in cells bearing the AML1/ETO and PML/RAR leukemogenic fusion proteins and is significantly repressed in a large proportion of acute myeloid leukemias. PIR expression increases during in vitro myeloid differentiation of primary hematopoietic precursor cells, and ablation of PIR in the U937 myelomonocytic cell line or in murine primary hematopoietic precursor cells results in impairment of terminal myeloid differentiation. Keywords: Transcriptional regulation, knock-down using shRNA We analyzed gene expression profiles of U937 cells after knock-down of PIR using the shPIR#7 oligonucleotides cloned in the pSICO-R lentiviral vector. No residual PIR protein is detectable in U937-shPIR#7 cells by Western blotting. U937 cells containing the empty cloning vector (U937-pSICO) were used as control. shPIR#7 oligonucleotide sequences: Human PIR#7-for: TGAAGCCACTTTGTCTTAATTTCAAGAGAATTAAGACAAAGTGGCTTCTTTTTTC Human PIR#7-rev: TCGAGAAAAAAGAAGCCACTTTGTCTTAATTCTCTTGAAATTAAGACAAAGTGGCTTCA For each sample, an RNA pool was obtained by mixing equal quantities of total RNA from each of three independent RNA extractions. Each biotin-labeled target was hybridized to two GeneChip HG-U133 Plus v.2 arrays.

ORGANISM(S): Homo sapiens

SUBMITTER: Myriam Alcalay

PROVIDER: E-GEOD-16798 | biostudies-arrayexpress |

REPOSITORIES: biostudies-arrayexpress

ACCESS DATA

Publications

Pirin downregulation is a feature of AML and leads to impairment of terminal myeloid differentiation.

Licciulli S S Cambiaghi V V Scafetta G G Gruszka A M AM Alcalay M M

Leukemia 20091210 2

Terminal differentiation of blood cells requires the concerted action of a series of transcription factors that are expressed at specific stages of maturation and function in a cell-type and dosage-dependent manner. Leukemogenic oncoproteins block differentiation by subverting the normal transcriptional status of hematopoietic precursor cells. Pirin (PIR) is a putative transcriptional regulator whose expression is silenced in cells bearing the acute myeloid leukemia-1 eight-twenty-one (AML1/ETO) ...[more]

PMID: 20010624

Similar Datasets

Project description:Nuclear factor erythroid 2-related factor 2 (NFE2L2, Nrf2) is an oxidant responsive transcription factor known to induce phase 2 detoxifying and antioxidant genes to protect cells from oxidative stress. Cigarette smoke, with its large oxidant content, is a major stressor to the small airway epithelium, the cells of which are vulnerable to oxidant damage and consequent malignant transformation. In this study, we assessed the role of cigarette smoke in activation of Nrf2 in the human small airway epithelium in vivo. Fiberoptic bronchoscopy was used to sample a pure population of small airway epithelium in 38 healthy nonsmokers and 45 healthy smokers, and gene expression was assessed using Affymetrix HG-U133 Plus 2.0 microarrays. Compared to that of healthy nonsmokers, Nrf2 protein was significantly activated in the small airway epithelium of healthy normal smokers and localized in the nucleus (p<0.05). Of the human homologs of 201 known murine Nrf2-mediated genes, 13 highly smoking-responsive genes were identified (p<10-4, all comparisons smokers to nonsmokers). Using a “Nrf2-index” to quantify the extent of expression in the small airway epithelium of these 13 known Nrf2 genes, variability in the level of expression was observed among the 45 healthy smokers, but the variability was coordinately modulated among the 13 genes, an observation confirmed by TaqMan quantitative PCR. This variability in the coordinate level of expression of the 13 Nrf2-mediated genes was independent of the smoking history. Based on these observations, the “Nrf2 index” was used to evaluate whether other genes modulated by smoking in the small airway epithelium were also coordinately up- or down- modulated among the 45 healthy smokers. Two genes, pirin (PIR) and UDP glucuronosyltransferase 1 family polypeptide A4 (UGT1A4), not previously known to be modulated by Nrf2 were identified as being coordinately modulated among the 45 smokers. Both genes contain several functional antioxidant response elements in the promoter region. Using an electrophoretic mobility shift assay, these antioxidant response elements in the promoters of PIR and UGT1A4 responded in vitro to activated Nrf2. These observations are consistent with the concept that Nrf2 plays an important role in regulating cellular defenses against smoking in the highly vulnerable small airway epithelium cell population, and that there is variability among the population in the relative Nrf2 responsiveness to a similar oxidant burden. Affymetrix arrays were used to assess gene expression data in small airway epithelium obtained by fiberoptic bronchoscopy of 38 healthy non-smokers and 45 healthy smokers

Project description:Background: The transcription factor EVI1 regulates cellular proliferation, differentiation, and apoptosis, and contributes to an aggressive course of disease in myeloid leukemias and other malignancies. Notwithstanding, knowledge about the target genes mediating its biological and pathological functions remains limited. We therefore aimed to identify and characterize novel EVI1 target genes in human myeloid cells. Methods: U937T_EVI1, a previously established human myeloid cell line expressing EVI1 in a tetracycline regulable manner, was subjected to genome wide gene expression microarray analysis. qRT-PCR was used to confirm the regulation of MS4A3 by EVI1. Reporter constructs containing various parts of the MS4A3 upstream region were employed in luciferase assays, and direct binding of EVI1 to the MS4A3 promoter was investigated by chromatin immunoprecipitation. U937 derivative cell lines experimentally expressing EVI1 and/or MS4A3 were generated by retroviral transduction, and tested for their tumorigenicity by subcutaneous injection into severe combined immunodeficient mice. Experimental results were tested for statistical significance using ANOVA and Student's t-test (two-tailed). Results: Gene expression microarray analysis identified 27 unique genes that were up-regulated and 29 that were down-regulated in response to EVI1 induction in the human myeloid cell line, U937. The most strongly repressed gene was membrane-spanning-4-domains subfamily-A member-3 (MS4A3), and its down-regulation by EVI1 was confirmed by qRT-PCR in additional, independent experimental model systems. Reporter gene assays and chromatin immunoprecipitation showed that EVI1 regulated MS4A3 via direct binding to a promoter proximal region. Experimental re-expression of MS4A3 in an EVI1 overexpressing cell line counteracted the tumor promoting effect of EVI1 in a murine xenograft model. Conclusions: Our data reveal MS4A3 as a novel direct target of EVI1 in human myeloid cells, and show that its repression plays a role in EVI1 mediated tumor aggressiveness. Time course of 2 biological replicates, plus 2 control samples; 20 arrays in total

Dataset Information

Genes regulated after knock-down of Pirin in U937 cells

Publications

Pirin downregulation is a feature of AML and leads to impairment of terminal myeloid differentiation.

Similar Datasets

OmicsDI is part of the ELIXIR infrastructure

Tweets