Ontology highlight
ABSTRACT:
PROVIDER: PRJNA977628 | ENA |
REPOSITORIES: ENA
Similar Datasets
Project description:The abundance of bacterial (AOB) and archaeal (AOA) ammonia oxidisers, assessed using quantitative PCR measurements of their respective a-subunit of the ammonia monooxygenase (amoA) genes, and ammonia oxidation rates were measured in four contrasting coastal sediments in the Western English Channel. Sediment was sampled bimonthly from July 2008 to May 2011, and measurements of ammonia oxidiser abundance and activity compared to a range of environmental variables including salinity, temperature, water column nutrients and sediment carbon and nitrogen content. Despite a higher abundance of AOA amoA genes within all sediments, and at all time-points, rates of ammonia oxidation correlated with AOB and not AOA amoA gene abundance. Other than ammonia oxidation rate, sediment particle size was the only variable that correlated with the spatial and temporal patterns of AOB amoA gene abundance, implying a preference of the AOB for larger sediment particles. This is possibly due to deeper oxygen penetration into the sandier sediments, increasing the area available for ammonia oxidation to occur, higher concentrations of inhibitory sulphide with pore waters of muddier sediments or a combination of both oxygen and sulphide concentrations. Similar to many other temporal studies of nitrification within estuarine and coastal sediments, decreases in AOB amoA gene abundance were evident during summer and autumn, with maximum abundance and ammonia oxidation rates occurring in winter and early spring. The lack of correlation between AOA amoA gene abundance and ammonium oxidation rate suggests an alternative role for amoA-carrying AOA within these sediments.
2013-08-24 | GSE50163 | GEO
Project description:This study evaluated the ammonium oxidizing communities (COA) associated with a potato crop (Solanum phureja) rhizosphere soil in the savannah of Bogotá (Colombia) by examining the presence and abundance of amoA enzyme genes and transcripts by qPCR and next-generation sequence analysis. amoA gene abundance could not be quantified by qPCR due to problems inherent in the primers; however, the melting curve analysis detected increased fluorescence for Bacterial communities but not for Archaeal communities. Transcriptome analysis by next-generation sequencing revealed that the majority of reads mapped to ammonium-oxidizing Archaea, suggesting that this activity is primarily governed by the microbial group of the Crenarchaeota phylum. In contrast,a lower number of reads mapped to ammonia-oxidizing bacteria.
2018-08-06 | GSE71824 | GEO
Project description:The abundance of bacterial (AOB) and archaeal (AOA) ammonia oxidisers, assessed using quantitative PCR measurements of their respective a-subunit of the ammonia monooxygenase (amoA) genes, and ammonia oxidation rates were measured in four contrasting coastal sediments in the Western English Channel. Sediment was sampled bimonthly from July 2008 to May 2011, and measurements of ammonia oxidiser abundance and activity compared to a range of environmental variables including salinity, temperature, water column nutrients and sediment carbon and nitrogen content. Despite a higher abundance of AOA amoA genes within all sediments, and at all time-points, rates of ammonia oxidation correlated with AOB and not AOA amoA gene abundance. Other than ammonia oxidation rate, sediment particle size was the only variable that correlated with the spatial and temporal patterns of AOB amoA gene abundance, implying a preference of the AOB for larger sediment particles. This is possibly due to deeper oxygen penetration into the sandier sediments, increasing the area available for ammonia oxidation to occur, higher concentrations of inhibitory sulphide with pore waters of muddier sediments or a combination of both oxygen and sulphide concentrations. Similar to many other temporal studies of nitrification within estuarine and coastal sediments, decreases in AOB amoA gene abundance were evident during summer and autumn, with maximum abundance and ammonia oxidation rates occurring in winter and early spring. The lack of correlation between AOA amoA gene abundance and ammonium oxidation rate suggests an alternative role for amoAÂ-carrying AOA within these sediments. Two color array (Cy3 and Cy5): the universal standard 20-mer oligo is printed to the slide with a 70-mer oligo (an archetype). Environmental DNA sequences (fluoresced with Cy3) within 15% of the 70-mer conjugated to a 20-mer oligo (fluoresced with Cy5) complementary to the universal standard will bind to the oligo probes on the array. Signal is the ratio of Cy3 to Cy5. Three replicate probes were printed for each archetype. Two replicate arrays were run on duplicate targets.
2013-08-24 | E-GEOD-50163 | biostudies-arrayexpress
Project description:Sequence of PCR amplicon created using bombicar primers for partial small ribosomal subunit of Nosema bombi
| PRJNA254791 | ENA
Project description:Microbiome PCR primer model is a Named Entity Recognition (NER) model that identifies and annotates microbiome target gene primers in texts. This is the final model version used to annotate metagenomics publications in Europe PMC and enrich metagenomics studies in MGnify with primer metadata from literature. For more information, please refer to the following blogs: http://blog.europepmc.org/2020/11/europe-pmc-publications-metagenomics-annotations.html https://www.ebi.ac.uk/about/news/service-news/enriched-metadata-fields-mgnify-based-text-mining-associated-publications
2022-02-21 | MODEL2202170011 | BioModels
Project description:4C-rDNA procedure was used for analysis of genomic contacts of rDNA units in HEK 293T cells. The primers for PCR amplification were selected upstream from EcoRI site (coordinate 30487 in the sequence with Accession number U13369.1): 5' TTCGCCTACGGATTTCTAGAAAATAA 3' and 5' AAAAGAAGCTCAAGTACATCTAATCTAA 3' (new primers).
2022-12-01 | GSE121363 | GEO