Genomics

Dataset Information

0

Genome-wide contacts of rDNA units detected by 4C procedure in human genome [new]

ABSTRACT: 4C-rDNA procedure was used for analysis of genomic contacts of rDNA units in HEK 293T cells. The primers for PCR amplification were selected upstream from EcoRI site (coordinate 30487 in the sequence with Accession number U13369.1): 5' TTCGCCTACGGATTTCTAGAAAATAA 3' and 5' AAAAGAAGCTCAAGTACATCTAATCTAA 3' (new primers).

ORGANISM(S): Homo sapiens

PROVIDER: GSE121363 | GEO | 2022/12/01

REPOSITORIES: GEO

Json Xml

Dataset's files

Source:
Action DRS
Other
Items per page:
1 - 1 of 1

Similar Datasets

Genomics Genome-wide contacts of rDNA units detected by 4C procedure in human genome [old]
2019-12-03 | GSE121413 | GEO
Genomics Genome-wide contacts of rDNA units detected by 4C procedure in human genome [old.hs]
2019-12-05 | GSE121417 | GEO
Other Genome-wide contacts of rDNA units detected by 4C procedure in human genome [hESM01]
2021-08-11 | GSE175909 | GEO
Genomics Hot spots of DNA double-strand breaks and genomic contacts of human rDNA units are involved in epigenetic regulation [rDNA units]
2014-10-04 | E-GEOD-49193 | biostudies-arrayexpress
Genomics Hot spots of DNA double-strand breaks and genomic contacts of human rDNA units are involved in epigenetic regulation [rDNA units]
2014-10-04 | GSE49193 | GEO
Other Genome-wide contacts of rDNA units detected by 4C procedure in human genome [K562]
2021-08-11 | GSE175910 | GEO
Other Genome-wide contacts of rDNA genes detected by 4C procedure (4C-rDNA) in Drosophila melanogaster S2 cells
2020-12-31 | GSE145321 | GEO
Genomics Genome-wide contacts of rDNA units detected by 4C procedure in human genome
2019-12-05 | GSE121418 | GEO
Genomics Genome-wide contacts of rDNA units detected by 4C procedure in human genome
| PRJNA497289 | ENA
Genomics Genome-wide contacts of rDNA units detected by 4C procedure in human genome [old]
| PRJNA497283 | ENA