Browse
Submit Data
Databases
API
Help

Dataset Information

0 Views

0 Connections

0 Citations

0 Reanalyses

0 Downloads

Omics score: 0

ABSTRACT: 16S rRNA full-length sequencing of DNA samples from ticks, Yunnan, China

PROVIDER: PRJNA979105 | ENA |

REPOSITORIES: ENA

ACCESS DATA

Json Xml

Dataset's files

Source:

			Action	DRS
	SRR24804376_subreads.fastq.gz	Fastqsanger.gz
	SRR24804377_subreads.fastq.gz	Fastqsanger.gz
	SRR24804378_subreads.fastq.gz	Fastqsanger.gz
	SRR24804379_subreads.fastq.gz	Fastqsanger.gz
	SRR24804380_subreads.fastq.gz	Fastqsanger.gz

Items per page:

1 - 5 of 8

Similar Datasets

Hhigh-throughput sequencing of in vitro fecal fermentation samples

Project description:We report the use of high-throughput sequencing technology to detect the microbial composition and abundance of mice grastic contents before and after Helicobacter pylori infection or Lactobacillus paracasei ZFM54 pretreatment/treatment. The genomic DNA was obtained by the QIAamp PowerFecal DNA Kit. Then, the DNA samples were sent to BGI Genomics Co., Ltd. (Shenzhen, China) for V3-V4 region of the 16S rRNA gene high-throughput sequencing with an Illumina MiSeq platform. DNA samples were sequenced using primers 338F (forward primer sequence ACTCCTACGGGAGGCAGCAG)-806R (reverse primer sequence GGACTACHVGGGTWTCTAAT). The sequencing analyses were carried out using silva138/16s database as a reference for the assignation of Amplicon Sequence Variant (ASV) at 100% similarity.

2022-07-27 | GSE208665 | GEO

Project description:Full-Length 16S rRNA Gene Sequencing

| PRJNA799457 | ENA

Project description:full-length 16S rRNA sequence

| PRJNA1073749 | ENA

Study of Gut Microbiome and Colorectal Tumors

Project description:Gut microbiota were assessed in 540 colonoscopy-screened adults by 16S rRNA gene sequencing of stool samples. Investigators compared gut microbiota diversity, overall composition, and normalized taxon abundance among these groups.

| 2255499 | ecrin-mdr-crc

The effect of IV iron on the gut microbiome in patients with metastatic colorectal cancer

Project description:Primary outcome(s): Analysis of the diversity and composition of the gut microbiome by 16S rRNA sequencing Study Design: Observational Study Model : Others, Time Perspective : Prospective, Enrollment : 60, Biospecimen Retention : Collect & Archive- Sample with DNA, Biospecimen Description : Blood, Stool

| 26030 | ecrin-mdr-crc

Chronic Strongyloides stercoralis infection increases Ruminococcus torques group and alter microbiome proteome in ivermectin treatment

Project description:The impact of mono-chronic S. stercoralis infection on the gut microbiome and microbial activities in infected participants was explored. The 16S rRNA gene sequencing of a longitudinal study with 2 sets of human fecal was investigated. Set A, 42 samples were matched, and divided equally into positive (Pos) and negative (Neg) for S. stercoralis diagnoses. Set B, 20 samples of the same participant in before (Ss+PreT) and after (Ss+PostT) treatment was subjected for 16S rRNA sequences and LC-MS/MS to explore the effect of anti-helminthic treatment on microbiome proteomes.

2023-11-07 | PXD037975 | JPOST Repository

Project description:16S rRNA full-length sequencing of the microbiota on the egg samples

| PRJNA1010744 | ENA

Project description:The full-length 16S rRNA gene for MOCK and real samples

| PRJNA1095240 | ENA

Airway Dysbiosis Accelerates Lung Function Decline in Chronic Obstructive Pulmonary Disease

Project description:This repository contains human sample derived microbiome full-length 16S rRNA sequencing data for sputum samples in COPD patients. The project goal is to understand the association of the lung microbiome with accelerated lung function decline in COPD patients.

| EGAS00001006444 | EGA

metagenome

Project description:16S rRNA full length sequencing of the Pearl River Estuary water environment samples

| PRJNA1057726 | ENA