Truncated protein isoforms generate diversity of protein localization and function in yeast
Ontology highlight
ABSTRACT:
PROVIDER: PRJNA987712 | ENA |
REPOSITORIES: ENA
Similar Datasets
Project description:Genome-wide measurements of ribosome occupancy on mRNA transcripts have enabled global empirical identification of translated regions. These approaches have revealed an unexpected diversity of protein products, but high-confidence identification of new coding regions that entirely overlap annotated coding regions – including those that encode truncated protein isoforms – has remained challenging. Here, we develop a sensitive and robust algorithm focused on identifying N-terminally truncated proteins genome-wide, identifying 388 truncated protein isoforms, a more than 30-fold increase in the number known in budding yeast. We perform extensive experimental validation of these truncated proteins and define two general classes. The first set lack large portions of the annotated protein sequence and tend to be produced from a truncated transcript. We show two such cases, Yap5truncation and Pus1truncation, to have condition-specific regulation and functions that appear distinct from their respective annotated isoforms. The second set of N-terminally truncated proteins lack only a small region of the annotated protein and are less likely to be regulated by an alternative transcript isoform. Many localize to different subcellular compartments than their annotated counterpart, representing a common strategy for achieving dual localization of otherwise functionally identical proteins.
2024-04-16 | GSE235852 | GEO
Project description:Abundance and localization of human UBE3A isoforms
| PRJNA512845 | ENA
Project description:The proper subcellular localization of RNAs and local translational regulation is crucial in highly compartmentalized cells, such as neurons. RNA localization is mediated by specific cis-regulatory elements usually found in mRNA 3'UTRs. Therefore, processes that generate alternative 3'UTRs – alternative splicing and polyadenylation – have the potential to diversify mRNA localization patterns in neurons. Here, we performed mapping of alternative 3'UTRs in neurites and soma isolated from mESC-derived neurons. Our analysis identified 593 genes with differentially localized 3'UTR isoforms. In particular, we have shown that two isoforms of Cdc42 gene with distinct functions in neuronal polarity are differentially localized between neurites and soma of mESC-derived and mouse primary cortical neurons, at both mRNA and protein level. Using reporter assays and 3'UTR swapping experiments, we have identified the role of alternative 3’UTRs and mRNA transport in differential localization of alternative CDC42 protein isoforms. Moreover, we used SILAC to identify isoform-specific Cdc42 3'UTR-bound proteome with potential role in Cdc42 localization and translation. Our analysis points to usage of alternative 3'UTR isoforms as a novel mechanism to provide for differential localization of functionally diverse alternative protein isoforms.
2018-12-07 | PXD011518 | Pride
Project description:The transcription factor FOXP1 is implicated in the pathogenesis of B-cell lymphomas through immunoglobulin heavy chain (IGH) locus-related chromosomal translocations leading to dysregulated expression of FOXP1. Translocations of FOXP1 with non-IG gene sequences have been also reported, but the molecular consequences of such aberrations remain undetermined. Here, using molecular cytogenetics and molecular biology studies, we comprehensively analyzed four lymphoma cases with non-IG rearrangements of FOXP1 and compared these with cases harboring t(3;14)(p13;q32)/IGH-FOXP1 and FOXP1-expressing lymphomas without underlying t(3p13/FOXP1). We found that non-IG rearrangements are usually acquired during evolution of lymphoma and constantly target the coding region of FOXP1, promiscuously fusing with coding and non-coding gene sequences at various reciprocal breakpoints (2q36, 10q24 and 3q11). Intriguingly, these rearrangements do not generate functional chimeric genes but commonly disrupt the full-length FOXP1 transcript leading to an aberrant expression of N-truncated FOXP1 isoforms, as shown by QRT-PCR and Western blot analysis. In contrast, cases with t(3;14)(p13;q32)/IGH-FOXP1 overexpress the full-length FOXP1. Collectively, our findings point to a dual mechanism through which FOXP1 is implicated in B-cell lymphomagenesis. The primary t(3;14)(p13;q32)/IGH-FOXP1 produces the full-length protein with potent oncogenic activity, whereas the secondary non-IG 17 rearrangements of FOXP1 generate N-truncated FOXP1 isoforms, likely driving progression of disease. Using molecular cytogenetics and molecular biology studies (including RNA-seq), we comprehensively analyzed four lymphoma cases with non-IG rearrangements of FOXP1 and compared these with cases harboring t(3;14)(p13;q32)/IGH-FOXP1 and FOXP1-expressing lymphomas without underlying t(3p13/FOXP1).
2013-09-04 | E-GEOD-50514 | biostudies-arrayexpress
Project description:The transcription factor FOXP1 is implicated in the pathogenesis of B-cell lymphomas through immunoglobulin heavy chain (IGH) locus-related chromosomal translocations leading to dysregulated expression of FOXP1. Translocations of FOXP1 with non-IG gene sequences have been also reported, but the molecular consequences of such aberrations remain undetermined. Here, using molecular cytogenetics and molecular biology studies, we comprehensively analyzed four lymphoma cases with non-IG rearrangements of FOXP1 and compared these with cases harboring t(3;14)(p13;q32)/IGH-FOXP1 and FOXP1-expressing lymphomas without underlying t(3p13/FOXP1). We found that non-IG rearrangements are usually acquired during evolution of lymphoma and constantly target the coding region of FOXP1, promiscuously fusing with coding and non-coding gene sequences at various reciprocal breakpoints (2q36, 10q24 and 3q11). Intriguingly, these rearrangements do not generate functional chimeric genes but commonly disrupt the full-length FOXP1 transcript leading to an aberrant expression of N-truncated FOXP1 isoforms, as shown by QRT-PCR and Western blot analysis. In contrast, cases with t(3;14)(p13;q32)/IGH-FOXP1 overexpress the full-length FOXP1. Collectively, our findings point to a dual mechanism through which FOXP1 is implicated in B-cell lymphomagenesis. The primary t(3;14)(p13;q32)/IGH-FOXP1 produces the full-length protein with potent oncogenic activity, whereas the secondary non-IG 17 rearrangements of FOXP1 generate N-truncated FOXP1 isoforms, likely driving progression of disease.
2013-09-04 | GSE50514 | GEO
Project description:Two distinct Tet1 isoforms are expressed, one encoding full-length TET1 (Tet1L) and the other a truncated transcript (Tet1S), lacking a large portion of the N-terminus. Each isoform displays unique transcriptional regulation, subcellular protein localization and enzymatic activity. In neurons, Tet1L and Tet1S govern the expression and methylation levels of distinct gene ensembles that when disrupted.
2021-02-01 | GSE140174 | GEO
Project description:Cdc42 is a small GTPase protein whose role in polarity is widely studied. However, in vertebrates there exist 2 isoforms arising due to alternative splicing. The function and localization of these have not been studied with respect to cell polarity and cell migration. We therefore perform a mass spec screen to identify interactors of the isoforms to better understand their cellular functions.
2024-01-23 | PXD017477 | Pride
Project description:Cryptic transcription is widespread and generates a heterogeneous group of RNA molecules of unknown function. To improve our understanding of cryptic transcription, we investigated their transcription start site usage, chromatin organization and post-transcriptional consequences in Saccharomyces cerevisiae. We show that transcription start sites of chromatin-dependent internal cryptic transcripts resemble those of protein coding genes in terms of DNA sequence, directionality and chromatin accessibility. We define the 5’ and 3’ boundaries of cryptic transcripts and show that, contrary to RNA degradation-dependent ones , they often overlap with the end of the gene thereby using the canonical polyadenylation site and associate to polyribosomes. In fact, we show that chromatin-dependent cryptic transcripts can be recognized by ribosomes and may produce truncated polypeptides from downstream, in-frame start codons. Our work suggests that a significant fraction of chromatin-dependent internal cryptic promoters are in fact alternative truncated mRNA isoforms. The expression of these chromatin-dependent isoforms is conserved from yeast to human expanding the functional consequences of cryptic transcription and proteome complexity.
2019-10-01 | GSE119114 | GEO
Project description:Eukaryotic genes generate multiple mRNA transcript isoforms though alternative transcription, splicing, and polyadenylation. However, the relationship between human transcript diversity and protein production is complex as each isoform can be translated differently. We fractionated a polysome profile and reconstructed transcript isoforms from each fraction, which we term Transcript Isoforms in Polysomes sequencing (TrIP-seq). Analysis of these data revealed regulatory features that control ribosome occupancy and translational output of each transcript isoform. We extracted a panel of 5′ and 3′ untranslated regions that control protein production from an unrelated gene in cells over a 100-fold range. Select 5′ untranslated regions exert robust translational control between cell lines, while 3′ untranslated regions can confer cell-type-specific expression. These results expose the large dynamic range of transcript-isoform-specific translational control, identify isoform-specific sequences that control protein output in human cells, and demonstrate that transcript isoform diversity must be considered when relating RNA and protein levels.
2016-01-11 | GSE69352 | GEO
Project description:Eukaryotic genes generate multiple mRNA transcript isoforms though alternative transcription, splicing, and polyadenylation. However, the relationship between human transcript diversity and protein production is complex as each isoform can be translated differently. We fractionated a polysome profile and reconstructed transcript isoforms from each fraction, which we term Transcript Isoforms in Polysomes sequencing (TrIP-seq). Analysis of these data revealed regulatory features that control ribosome occupancy and translational output of each transcript isoform. We extracted a panel of 5â?² and 3â?² untranslated regions that control protein production from an unrelated gene in cells over a 100-fold range. Select 5â?² untranslated regions exert robust translational control between cell lines, while 3â?² untranslated regions can confer cell-type-specific expression. These results expose the large dynamic range of transcript-isoform-specific translational control, identify isoform-specific sequences that control protein output in human cells, and demonstrate that transcript isoform diversity must be considered when relating RNA and protein levels. Total cytoplasmic and eight polysomal fractions of RNA were purified from HEK 293T cells in biological duplicate. Ribosomal RNA was depleted using Ribo-Zero (Human/Mouse/Rat; Epicenter) and libraries were prepared using the TruSeq RNA v2 kit (RS-122-2001; Illumina) skipping the polyA selection step. Reads are paired-end 75bp and sequencing adapters are GATCGGAAGAGCACACGTCTGAACTCCAGTCAC (read1) and AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT (read2).
2016-01-11 | E-GEOD-69352 | biostudies-arrayexpress