Browse
Submit Data
Databases
API
Help

Dataset Information

0 Views

0 Connections

0 Citations

0 Reanalyses

0 Downloads

Omics score: 0

Squaliformes

ABSTRACT: Shark feces DNA raw sequence reads

PROVIDER: PRJNA993410 | ENA |

REPOSITORIES: ENA

ACCESS DATA

Json Xml

Dataset's files

Source:

			Action	DRS
	SRR26288300_1.fastq.gz	Fastqsanger.gz
	SRR26288300_2.fastq.gz	Fastqsanger.gz
	SRR26288301_1.fastq.gz	Fastqsanger.gz
	SRR26288301_2.fastq.gz	Fastqsanger.gz
	SRR26288302_1.fastq.gz	Fastqsanger.gz

Items per page:

1 - 5 of 116

Similar Datasets

Morus alba Raw protein sequence reads

Project description:Morus alba L. Raw protein sequence reads and sequence

2024-02-08 | PXD049451 |

High-throughput sequencing of in vitro fecal fermentation samples

Project description:We report the use of high-throughput sequencing technology to detect the microbial composition and abundance of human feces after in vitro co-fermentation with citrus peel flavonoid extracts. The genomic DNA was obtained by the QIAamp PowerFecal DNA Kit. Then, the DNA samples were sent to Biomarker Bio-Tech (Beijing, China) for V3-V4 region of the 16S rDNA gene high-throughput sequencing with an Illumina MiSeq platform. DNA samples were sequenced using primers 338F (forward primer sequence ACTCCTACGGGAGGCAGCAG)-806R (reverse primer sequence GGACTACHVGGGTWTCTAAT). A total of 8,816,250 pairs of Reads were obtained from the 112 samples sequenced, and 8,721,112 Clean Reads were generated from the double-ended Reads after quality control and splicing. The sequencing analyses were carried out using the SILVA database as a reference for the assignation of operational taxonomic units (OTUs) with 97% of identity.

2022-04-02 | GSE199749 | GEO

Analysis of SOD1 binding sites by next generation sequencing under different redox environments

Project description:We report the application of ChIP-Seq technology for analyzing the DNA binding sites of SOD1 in the nucleus of HeLa cells. By obtaining a plenty of sequence from chromatin immunoprecipitated DNA, we generated genome-wide DNA binding sites of SOD1. After sequencing of ChIP samples, 42,737,195, 49,950,032, and 38,825,768 clean reads for control group, H2O2 treated group and LD100 (a specific inhibitor of SOD1) treated group were obtained through trimming the raw reads. We find that SOD1 occupies DNA sites with distinct sequence preference in the nucleus. The treatment with either H2O2 or LD100 was found to decrease the strength of SOD1 binding to DNA, indicating that the H2O2 exposure- or SOD1 inhibition-mediated redox dyshomeostasis may result in decreased genes that are reasonably regulated through alteration of SOD1 structures compared to control.

2018-12-20 | GSE124082 | GEO

High-throughput sequencing reveals a simple model of nucleosome energetics

Project description:We use nucleosome maps obtained by high-throughput sequencing to study sequence specificity of intrinsic histone-DNA interactions. In contrast with previous approaches, we employ an analogy between a classical one-dimensional fluid of finite-size particles in an arbitrary external potential and arrays of DNA-bound histone octamers. We derive an analytical solution to infer free energies of nucleosome formation directly from nucleosome occupancies measured in high-throughput experiments. The sequence-specific part of free energies is then captured by fitting them to a sum of energies assigned to individual nucleotide motifs. We have developed hierarchical models of increasing complexity and spatial resolution, establishing that nucleosome occupancies can be explained by systematic differences in mono- and dinucleotide content between nucleosomal and linker DNA sequences, with periodic dinucleotide distributions and longer sequence motifs playing a secondary role. Furthermore, similar sequence signatures are exhibited by control experiments in which genomic DNA is either sonicated or digested with micrococcal nuclease in the absence of nucleosomes, making it possible that current predictions based on highthroughput nucleosome positioning maps are biased by experimental artifacts. Included are raw (eland) and mapped (wig) reads. The mapped reads are provided in eland and wiggle formats, and the raw reads are included in the eland file. This series includes only Mnase control data. The sonicated control is part of this already published accession, as is a in vitro nucleosome map: http://www.ncbi.nlm.nih.gov/geo/query/acc.cgi?acc=GSE15188 We also studied data (in vitro and in vivo maps as well as a model) from http://www.ncbi.nlm.nih.gov/geo/query/acc.cgi?acc=GSE13622 and from: http://www.ncbi.nlm.nih.gov/sra/?term=SRA001023

2010-08-20 | E-GEOD-23712 | biostudies-arrayexpress

Exome sequencing in classic Hairy cell leukaemia reveals widespread variation in acquired somatic mutations between individual tumours apart from the signature BRAF V(600)E lesion

Project description:Whole exome sequencing of 5 HCLc tumor-germline pairs. Genomic DNA from HCLc tumor cells and T-cells for germline was used. Whole exome enrichment was performed with either Agilent SureSelect (50Mb, samples S3G/T, S5G/T, S9G/T) or Roche Nimblegen (44.1Mb, samples S4G/T and S6G/T). The resulting exome libraries were sequenced on the Illumina HiSeq platform with paired-end 100bp reads to an average depth of 120-134x. Bam files were generated using NovoalignMPI (v3.0) to align the raw fastq files to the reference genome sequence (hg19) and picard tools (v1.34) to flag duplicate reads (optical or pcr), unmapped reads, reads mapping to more than one location, and reads failing vendor QC.

2016-02-01 | E-MTAB-4313 | biostudies-arrayexpress

Feces

Project description:Feces Raw sequence reads

| PRJNA876598 | ENA

feces

Project description:feces Raw sequence reads

| PRJNA699385 | ENA

feces

Project description:feces Raw sequence reads

| PRJNA1145153 | ENA

feces

Project description:feces Raw sequence reads