Browse
Submit Data
Databases
API
Help

Dataset Information

0 Views

0 Connections

0 Citations

0 Reanalyses

0 Downloads

Omics score: 0

E-GEOD-21912

ABSTRACT: Transcription profiling by array of human multiple myeloma cells after infection with a shRNA targeting BMI1

OTHER RELATED OMICS DATASETS IN: PRJNA126835

PROVIDER: E-GEOD-21912 | ExpressionAtlas | 2025-01-24

REPOSITORIES: ExpressionAtlas

ACCESS DATA

Json Xml

Dataset's files

Source:

			Action	DRS
	E-GEOD-21912-analysis-methods.tsv	Tabular
	E-GEOD-21912-atlasExperimentSummary.Rdata	Rdata
	E-GEOD-21912-configuration.xml	Xml
	E-GEOD-21912-percentile-ranks.tsv	Tabular
	E-GEOD-21912.condensed-sdrf.tsv	Tabular

Items per page:

1 - 5 of 53

Similar Datasets

Transcription profiling of human multiple myeloma cells to compare the effect of CS1 expression levels.

Project description:We used microarrays to detail the global programme of gene expression underlying CS1-regulated biological processes including increased cell adhesion and cell proliferation. Experiment Overall Design: Human multiple myeloma cell lines with and without CS1 expression, either by transffecting CS1 overexpressing vector or lentiviral CS1 shRNA, were subject to total RNA extraction and hybridization on Affymetrix microarrays. We sought to define the common genes underexpressed in CS1 knockdown myeloma cells whereas overexpressed in CS1 overexpressing myeloma cells to gain insight into CS1-targeting genes in order to define the molecular mechanisms regulated by CS1 in multiple myeloma.

2009-02-21 | E-GEOD-14680 | biostudies-arrayexpress

Gene expression profiles of RPMI8226 cells after knockdown of KDM3A and KLF2

Project description:Recent studies have implicated KDM3A, which catalyzes removal of H3K9 methylation, is associated with tumorigenesis. However, the biological role of KDM3A in multiple myeloma, has not been delineated. Here we identify KDM3A-KLF2-IRF4 axis dependence in multiple myeloma. We demonstrate that knockdown of KDM3A leads to apoptosis and significant growth inhibition in myeloma cells. Mechanistically, KDM3A directly regulates myeloma cell survival factor IRF4 expression through H3K9 demethylation at its promoter. We further show that KDM3A directly regulates KLF2 expression and that knockdown of KLF2 leads to growth inhibition in myeloma cells. The goal of this analysis is to identify genes whose expression changes after shRNA-mediated knockdown of KDM3A and KLF2 using the human U133 plus 2.0 Affymetrix GeneChip in myeloma cell line (RPMI8226). Two independent experiments were performed: 1. Myeloma cell line (RPMI8226) was transduced with either shRNAs targeting KDM3A (duplicate hairpins) or luciferase (control) in duplicate. The gene expression profiles of KDM3A knockdown cells were compared with that of control cells. A total of 6 RNA samples (4 KDM3A knockdown and 2 control) were analyzed. 2. Myeloma cell line (RPMI8226) was transduced with either shRNAs targeting KLF2 (duplicate hairpins) or luciferase (control) in duplicate. The gene expression profiles of KLF2 knockdown cells were compared with that of control cells. A total of 6 RNA samples (4 KLF2 knockdown and 2 control) were analyzed.

2015-02-18 | E-GEOD-55667 | biostudies-arrayexpress

Preclinical and first-in-human of Purinostat Mesylate, a novel selective HDAC I/IIb inhibitor, in relapsed or refractory multiple myeloma and lymphoma

Project description:To investigate the effects of the I/IIb HDAC inhibitor, Purinostat Mesylate (PM, also called HL13) on gene expression in multiple myeloma. The MM.1S cells were treated with Ctrl (DMSO) or HL13 (5nM) for 24 hours. Then the cells were collected and total RNA were isolation by Trizol. The expression profiling by array generated following the recommended protocol of Affymetrix GeneChip Human Transcriptome Array 2.0. To investigate the effects of the I/IIb HDAC inhibitor, Purinostat Mesylate (PM, also called HL13) on gene expression in multiple myeloma. The MM.1S cells were treated with Ctrl (DMSO) or HL13 (5nM) for 24 hours. Then the cells were collected and total RNA were isolation by Trizol. The expression profiling by array generated following the recommended protocol of Affymetrix GeneChip Human Transcriptome Array 2.0.

2025-07-01 | GSE296480 | GEO

Targeting aberrant DNA methylation in mesenchymal stromal cells as a treatment for myeloma bone disease [expression]

Project description:Gene expression profiling of bone marrow-derived mesenchymal stromal cells from healthy donors (n=8), monoclonal gammopathy of undetermined significance (MGUS) (n=10), smoldering myeloma (SMM) (n=10) and multiple myeloma (MM) (n=24) patients. Gene expression profile of MSCs was obtained using high density oligonucleotide microarrays (Human Gene 1.0 ST Array from Affymetrix).

2020-11-25 | GSE137369 | GEO

The Polycomb Group Protein Bmi-1 is essential for the growth of Multiple Myeloma cells

Project description:The RPMI-8226 human multiple myeloma cell line was stably infected with either a validated shRNA against BMI1 or a control shRNA. RNA was prepared from these lines, +/- doxycycline induction and at various time points post-induction. Samples were hybridized on the Affymetrix U133plus2 human genome expression microarray. The RPMI-8226 human multiple myeloma cell line was stably infected with either a validated shRNA against BMI1 or a control shRNA. RNA was prepared from these lines, +/- doxycycline induction and at various time points post-induction. Samples were hybridized on the Affymetrix U133plus2 human genome expression microarray.

2010-06-09 | E-GEOD-21912 | biostudies-arrayexpress

Drug resistance-related changes in gene expression profile in multiple myeloma

Project description:1) We identified the genes whose expression was up- and down-regulated by the adhesion to bone marrow stromal cells in human multiple myeloma cell line RPMI8226. 2) We identified the genes whose expression was up- and down-regulated by the PI3K inhibitor PF-04691502 in human multiple myeloma cell line RPMI8226. We isolated mRNA from the multiple myeloma cell line RPMI8226 under drug-resistant conditions, and subjected them to gene expression profiling using an Agilent GeneChip Array.

2015-03-04 | E-GEOD-66466 | biostudies-arrayexpress

Microarray of ZEB1 Loss-of-Function in NCH421K cells

Project description:Here we performed a microarray experiment on samples of adherent cultures of Human Glioblastoma Cancer Stem Like Cells (NCH421K cell line) expressing a shRNA targeting the transcription factor ZEB1 (shZEB1) or a control shRNA targeting GFP 72 hours after lentiviral infection. This resulted in the generation of a genome-wide mRNA expression pattern and quantification for these cells in the two conditions.

2018-04-24 | E-MTAB-5543 | biostudies-arrayexpress

Transcription profiling of human multiple myeloma cells ( MM1.S) cells with control or beta-catenin knockdown.

Project description:MM1.S cells stably transduced with control or beta-catenin shRNA were established. Total RNA was isolated from 5x 10^6 cells of each in triplicate. Experiment Overall Design: Comparative gene expression profiling in multiple myeloma.

2009-09-15 | E-GEOD-17385 | biostudies-arrayexpress

Gene expression profile of ETV1 knockdown in LNCaP prostate cancer cells

Project description:Over half of prostate cancer harbor overexpression of ETS transcription factors including ERG and ETV1. LNCaP prostate cancer cells have an ETV1 translocation to the MIPOL1 locus on 14q13.3-13q21.1. To determine genes regulated by ETV1, we performed shRNA mediated knockdown of ETV1 using two lentiviral constructs as well as a scrambled shRNA in triplicate. Two pLKO.1 constructs against ETV1 (ETV1sh1: TRCN0000013923, targeting GTGGGAGTAATCTAAACATTT in 3'(B UTR; and ETV1sh2: TRCN0000013925, targeting CGACCCAGTGTATGAACACAA in exon 7) were purchased from Open Biosystems and pLKO.1 shScr (targeting CCTAAGGTTAAGTCGCCCTCG) was purchased from Addgene. RNA was harvested 3 days after infection and gene expression profiling was performed. Among genes downregulated were many well characterized androgen regulated genes. LNCaP cells logarthmically growing in full serum was infected with three different shRNA lentiviruses. Three days after infection

2013-05-10 | E-GEOD-46329 | biostudies-arrayexpress

Human IL-6 fosters long-term engraftment of human patient derived myeloma cells in immunodeficient mice

Project description:Multiple myeloma is a largely incurable and life-threatening malignancy of antibody-secreting plasma cells. An effective and widely available animal model that recapitulates human myeloma and related plasma cell disorders is lacking. We show that busulfan-conditioned hIL-6 transgenic NSG mice (NSG+hIL6) reliably support the engraftment of malignant and pre-malignant human plasma cells including from patients diagnosed with pre- and post-relapse myeloma, plasma cell leukemia, and AL amyloidosis. Consistent with human disease, NSG+hIL6 mice engrafted with patient-derived myeloma cells developed blood M spikes, and a majority developed anemia, hypercalcemia, and/or bone lesions. Singe cell RNAseq analyses showed non-malignant and malignant cell engraftment, the latter expressing a wide array of mRNAs associated with myeloma cell survival and proliferation. Myeloma-engrafted mice given CAR T-cells targeting plasma cells or bortezomib experienced reduced tumor burden. Our results establish that NSG+hIL6 mice provide an effective patient derived xenograft model for study and preclinincal drug development for myeloma and related plasma cell disorders.

2024-10-14 | GSE246140 | GEO

OmicsDI is part of the ELIXIR infrastructure

OmicsDI is an Elixir interoperability service. Learn more ›

Tweets

OmicsDI Databases

PRIDE
PeptideAtlas
MassIVE
JPOST Repository
Physiome Model Repository

EGA
EVA
ENA
LINCS
PAXDB
Cell Collective

MetaboLights
Metabolomics Workbench
MetabolomeExpress
GNPS
BioModels
FAIRDOMHub

ArrayExpress
dbGaP
ExpressionAtlas
GEO
NODE

Information

Databases
Help
API
Contact us
Code on GitHub
Terms of use
Submit Data