Genes regulated after transient knock-down of Pirin in WM-266 cells
Ontology highlight
ABSTRACT:
ORGANISM(S): Homo sapiens
PROVIDER: GSE17551 | GEO | 2010/08/04
SECONDARY ACCESSION(S): PRJNA118529
REPOSITORIES: GEO
Similar Datasets
Project description:Pirin (PIR) is a putative transcriptional regulator abundantly expressed in melanocytes and in a subset of primary and metastatic melanomas. Ablation of PIR in the melanoma cell lines results in induction of a senescence-like phenotype. Keywords: Transcriptional regulation, knock-down using siRNA We analyzed gene expression profiles of WM-266.4 metastatic melanoma cells after knock-down of PIR, which was achieved using a pool of four PIR-siRNA duplexes (siPIR). A pool of four non-targeting siRNA duplexes was used as control of off-target transcriptional effects (siCTR). Cells that underwent transfection with no oligonucleotides (oligofectamine only) were also included to measure all non-specific effects (NO cells). For each sample, an RNA pool was obtained by mixing equal quantities of total RNA from each of three independent RNA extractions. Each biotin-labeled target was hybridized to two GeneChip HG-U133 Plus v.2 arrays.
2010-08-04 | E-GEOD-17551 | biostudies-arrayexpress
Project description:Pirin (PIR) is a putative transcriptional regulator abundantly expressed in melanocytes and in a subset of primary and metastatic melanomas. Ablation of PIR in the melanoma cell lines results in induction of a senescence-like phenotype. Keywords: Transcriptional regulation, knock-down using siRNA We analyzed gene expression profiles of WM-266.4 metastatic melanoma cells after knock-down of PIR, which was achieved using a pool of four PIR-siRNA duplexes (siPIR). A pool of four non-targeting siRNA duplexes was used as control of off-target transcriptional effects (siCTR). Cells that underwent transfection with no oligonucleotides (oligofectamine only) were also included to measure all non-specific effects (NO cells). For each sample, an RNA pool was obtained by mixing equal quantities of total RNA from each of three independent RNA extractions. Each biotin-labeled target was hybridized to two GeneChip HG-U133 Plus v.2 arrays.
| S-ECPF-GEOD-17551 | biostudies-other
Project description:Pirin (PIR) is a putative transcriptional regulator whose expression is silenced in cells bearing the AML1/ETO and PML/RAR leukemogenic fusion proteins and is significantly repressed in a large proportion of acute myeloid leukemias. PIR expression increases during in vitro myeloid differentiation of primary hematopoietic precursor cells, and ablation of PIR in the U937 myelomonocytic cell line or in murine primary hematopoietic precursor cells results in impairment of terminal myeloid differentiation. Keywords: Transcriptional regulation, knock-down using shRNA
2009-12-10 | GSE16798 | GEO
Project description:Pirin (PIR) is a putative transcriptional regulator whose expression is silenced in cells bearing the AML1/ETO and PML/RAR leukemogenic fusion proteins and is significantly repressed in a large proportion of acute myeloid leukemias. PIR expression increases during in vitro myeloid differentiation of primary hematopoietic precursor cells, and ablation of PIR in the U937 myelomonocytic cell line or in murine primary hematopoietic precursor cells results in impairment of terminal myeloid differentiation. Keywords: Transcriptional regulation, knock-down using shRNA We analyzed gene expression profiles of U937 cells after knock-down of PIR using the shPIR#7 oligonucleotides cloned in the pSICO-R lentiviral vector. No residual PIR protein is detectable in U937-shPIR#7 cells by Western blotting. U937 cells containing the empty cloning vector (U937-pSICO) were used as control. shPIR#7 oligonucleotide sequences: Human PIR#7-for: TGAAGCCACTTTGTCTTAATTTCAAGAGAATTAAGACAAAGTGGCTTCTTTTTTC Human PIR#7-rev: TCGAGAAAAAAGAAGCCACTTTGTCTTAATTCTCTTGAAATTAAGACAAAGTGGCTTCA For each sample, an RNA pool was obtained by mixing equal quantities of total RNA from each of three independent RNA extractions. Each biotin-labeled target was hybridized to two GeneChip HG-U133 Plus v.2 arrays.
2009-12-10 | E-GEOD-16798 | biostudies-arrayexpress
Project description:Gene knock-down in plants is a useful approach to study genotype-phenotype relationships, render disease resistance to crops, and enable efficient biosynthesis of molecules in plants. Small interfering RNA (siRNA)-mediated gene silencing is one of the most common ways to achieve gene knock-down in plants. Traditionally, siRNA is delivered into intact plant cells by coding the siRNA sequences into DNA vectors, which are then delivered through viral and/or bacterial methods. In this protocol, we provide an alternative direct delivery method of siRNA molecules into intact plant cells for efficient transient gene knock-down in model tobacco plant, Nicotiana benthamiana, leaves. Our approach uses one dimensional carbon-based nanomaterials, single-walled carbon nanotubes (SWNTs), to deliver siRNA, and does not rely on viral/bacterial delivery. The distinct advantages of our method are i) there is no need for DNA coding of siRNA sequences, ii) this abiotic method could work in a broader range of plant species than biotic methods, and iii) there are fewer regulatory complications when using abiotic delivery methods, whereby gene silencing is transient without permanent modification of the plant genome. Graphic abstract.
| S-EPMC7953349 | biostudies-literature
Project description:Cutaneous melanoma is a malignant tumor of skin melanocytes that are pigment-producing cells located in the basal layer (stratum basale) of epidermis. Accumulation of genetic mutations within their oncogenes or tumor-suppressor genes compels melanocytes to aberrant proliferation and spread to distant organs of the body, thereby resulting in severe and/or lethal malignancy. Metastatic melanoma's heavy mutational load, molecular heterogeneity and resistance to therapy necessitate the development of novel biomarkers and drug-based protocols that target key proteins involved in perpetuation of the disease. To this direction, we have herein employed a nano liquid chromatography-tandem mass spectrometry (nLC-MS/MS) proteomics technology to profile the deep-proteome landscape of WM-266-4 human metastatic melanoma cells. Our advanced melanoma-specific catalogue proved to contain 6,681 unique proteins, which likely constitute the hitherto largest single cell-line-derived proteomic collection of the disease. Through engagement of UNIPROT, DAVID, KEGG, PANTHER, INTACT, CYTOSCAPE, dbEMT and GAD bioinformatics resources, WM-266-4 melanoma proteins were categorized according to their sub-cellular compartmentalization, function and tumorigenicity, and successfully reassembled in molecular networks and interactomes. The obtained data dictate the presence of plastically inter-converted sub-populations of non-cancer and cancer stem cells, and also indicate the oncoproteomic resemblance of melanoma to glioma and lung cancer. Intriguingly, WM-266-4 cells seem to be subjected to both epithelial-to-mesenchymal (EMT) and mesenchymal-to-epithelial (MET) programs, with 1433G and ADT3 proteins being identified in the EMT/MET molecular interface. Oncogenic addiction of WM-266-4 cells to autocrine/paracrine signaling of IL17-, DLL3-, FGF(2/13)- and OSTP-dependent sub-routines suggests their critical contribution to the metastatic melanoma chemotherapeutic refractoriness. Interestingly, the 1433G family member that is shared between the BRAF- and EMT/MET-specific interactomes likely emerges as a novel and promising druggable target for the malignancy. Derailed proliferation and metastatic capacity of WM-266-4 cells could also derive from their metabolic addiction to pathways associated with glutamate/ammonia, propanoate and sulfur homeostasis, whose successful targeting may prove beneficial for advanced melanoma-affected patients.
| S-EPMC5291375 | biostudies-literature
Project description:This SuperSeries is composed of the following subset Series: GSE31350: Transcriptomic analysis of the effect of CT16 (PAGE5) expression in WM-266-4 melanoma cells GSE31351: Transcriptomic analysis of the effect of CT16 (PAGE5) silencing by RNAi in A2058 melanoma cells Refer to individual Series
| S-ECPF-GEOD-31352 | biostudies-other
Project description:The cellular gene expression profiles were investigated in CT16 (PAGE5) negative WM-266-4 melanoma cells as well as in the WM-266-4 cells expressing transfected CT16 cDNA. Total RNA obtained from three individual cultures of WM-266-4 cells stably transfected with CT16 cDNA- containing plasmid and from three individual cultures of WM-266-4 cells stably transfected with intact vector.
| S-ECPF-GEOD-31350 | biostudies-other
Project description:In normal skin, interactions between melanocytes and keratinocytes, and between melanocytes and the basal membrane are functionally relevant for maintenance of homeostasis and epidermal melanin unit whose deregulation may trigger a continuous proliferation of the melanocytes. In order to further elucidate the molecular events related to cell-cell and cell-ECM interactions in relation to the biology of melanomas, we analyzed the expression profile of 64 human melanomas, 21 primary samples and 43 independent metastasis.
2011-10-31 | GSE17275 | GEO
Project description:We report the gene expression comparison of zebrafish melanocytes and melanomas. These comparisons were used for integrative genomic studies that identified the BMP factor GDF6 as a new oncogene that is specifically expressed in melanomas.
2018-02-14 | GSE83399 | GEO