Browse
Submit Data
Databases
API
Help

Dataset Information

0 Views

0 Connections

0 Citations

0 Reanalyses

0 Downloads

Omics score: 0

Genes regulated after knock-down of Pirin in U937 cells

ABSTRACT: Pirin (PIR) is a putative transcriptional regulator whose expression is silenced in cells bearing the AML1/ETO and PML/RAR leukemogenic fusion proteins and is significantly repressed in a large proportion of acute myeloid leukemias. PIR expression increases during in vitro myeloid differentiation of primary hematopoietic precursor cells, and ablation of PIR in the U937 myelomonocytic cell line or in murine primary hematopoietic precursor cells results in impairment of terminal myeloid differentiation. Keywords: Transcriptional regulation, knock-down using shRNA

ORGANISM(S): Homo sapiens

PROVIDER: GSE16798 | GEO | 2009/12/10

SECONDARY ACCESSION(S): PRJNA117507

REPOSITORIES: GEO

ACCESS DATA

Json Xml

Dataset's files

Source:

			Action	DRS
		Other

Items per page:

1 - 1 of 1

Similar Datasets

Genes regulated after knock-down of Pirin in U937 cells

Project description:Pirin (PIR) is a putative transcriptional regulator whose expression is silenced in cells bearing the AML1/ETO and PML/RAR leukemogenic fusion proteins and is significantly repressed in a large proportion of acute myeloid leukemias. PIR expression increases during in vitro myeloid differentiation of primary hematopoietic precursor cells, and ablation of PIR in the U937 myelomonocytic cell line or in murine primary hematopoietic precursor cells results in impairment of terminal myeloid differentiation. Keywords: Transcriptional regulation, knock-down using shRNA We analyzed gene expression profiles of U937 cells after knock-down of PIR using the shPIR#7 oligonucleotides cloned in the pSICO-R lentiviral vector. No residual PIR protein is detectable in U937-shPIR#7 cells by Western blotting. U937 cells containing the empty cloning vector (U937-pSICO) were used as control. shPIR#7 oligonucleotide sequences: Human PIR#7-for: TGAAGCCACTTTGTCTTAATTTCAAGAGAATTAAGACAAAGTGGCTTCTTTTTTC Human PIR#7-rev: TCGAGAAAAAAGAAGCCACTTTGTCTTAATTCTCTTGAAATTAAGACAAAGTGGCTTCA For each sample, an RNA pool was obtained by mixing equal quantities of total RNA from each of three independent RNA extractions. Each biotin-labeled target was hybridized to two GeneChip HG-U133 Plus v.2 arrays.

2009-12-10 | E-GEOD-16798 | biostudies-arrayexpress

Dynamic gene expression response to altered gravity in human myelomonocytic U937 cells [parabolic]

Project description:We investigated differentially regulated genes in human myelomonocytic U937 cells in 20s and 5min microgravity and in hypergravity and compared expression profiles to identify potential gravity-regulated genes and adaptation processes.

2018-10-16 | GSE101212 | GEO

Genes regulated after transient knock-down of Pirin in WM-266 cells

2010-08-04 | GSE17551 | GEO

Dynamic gene expression response to altered gravity in human myelomonocytic U937 cells [sounding rocket]

2018-10-16 | GSE101299 | GEO

DNA methylation analysis of the U937 cell line

Project description:DNA methylation profiling of gene promoters in the human myeloid cell line U937. Bisulphite converted DNA from wildtype U937 cells was hybridised to the Illumina Infinium HumanMethylation27 BeadChip to determine the methylation pattern of the U937 cell line.

2014-09-26 | E-GEOD-60734 | biostudies-arrayexpress

DNA methylation analysis of the U937 cell line

Project description:DNA methylation profiling of gene promoters in the human myeloid cell line U937.

2014-09-26 | GSE60734 | GEO

Genes regulated after transient knock-down of Pirin in WM-266 cells

Project description:Pirin (PIR) is a putative transcriptional regulator abundantly expressed in melanocytes and in a subset of primary and metastatic melanomas. Ablation of PIR in the melanoma cell lines results in induction of a senescence-like phenotype. Keywords: Transcriptional regulation, knock-down using siRNA We analyzed gene expression profiles of WM-266.4 metastatic melanoma cells after knock-down of PIR, which was achieved using a pool of four PIR-siRNA duplexes (siPIR). A pool of four non-targeting siRNA duplexes was used as control of off-target transcriptional effects (siCTR). Cells that underwent transfection with no oligonucleotides (oligofectamine only) were also included to measure all non-specific effects (NO cells). For each sample, an RNA pool was obtained by mixing equal quantities of total RNA from each of three independent RNA extractions. Each biotin-labeled target was hybridized to two GeneChip HG-U133 Plus v.2 arrays.

2010-08-04 | E-GEOD-17551 | biostudies-arrayexpress

U937 ctrl vs U937 Saha (Vorinostat; suberoylanilide hydroxamic acid) 6h

Project description:miRNA expression profiling of U937 ctrl vs U937 treated Saha 5 µM 6h

2017-05-22 | GSE69957 | GEO

Effects of PMA on exon usage of HL60, THP-1, and U937 cells

Project description:Myeloid leukemia cell lines HL60, THP-1, and U937 undergo macrophage-like differentiation after treatment with phorbol ester. To explore genes whose exon usage was altered during macrophage differentiation, we compared exome of PMA-treated (differentated) and vehicle-treated (undifferentiated) myeloid cell lines. HL60, THP-1, and U937 cells were treated with either phorbol 12-myristate 13-acetate (PMA,30nM) or its vehicle (DMSO) for 3 days, and subjected to exome analysis using Affymetrix human exon 1.0ST arrays.

2013-09-25 | E-GEOD-20567 | biostudies-arrayexpress

U937 scramble (Usc) vs U937 miR-194-5p (UmiR-194-5p)

Project description:Transcriptional profiling of U937 scramble vs U937 miR-194-5p (UmiR-194-5p)

2017-05-22 | GSE73646 | GEO