Browse
Submit Data
Databases
API
Help

Unknown,Transcriptomics,Genomics,Proteomics

Dataset Information

0 Views

0 Connections

0 Citations

0 Reanalyses

0 Downloads

Omics score: 0

Transcription profiling of human HT29 colorectal adenocarcinoma cell line treated with apratoxin A vs. controls to determine the mode of action of apratoxin A

ABSTRACT: Total RNA was extracted from apratoxin A or vehicle treated HT29 cells using the RNeasy Mini Kit (Qiagen). Probe values from CEL files were condensed to probe sets using Rosetta Resolver software. Resolver ANOVA analysis was then performed between groups. Experiment Overall Design: 2 doses were compared to vehicle at 3 time points. Each time point had its own vehicle control

ORGANISM(S): Homo sapiens

SUBMITTER: John Walker

PROVIDER: E-GEOD-2742 | biostudies-arrayexpress |

REPOSITORIES: biostudies-arrayexpress

ACCESS DATA

Json Xml

Publications

A functional genomics approach to the mode of action of apratoxin A.

Luesch Hendrik H Chanda Sumit K SK Raya R Marina RM DeJesus Paul D PD Orth Anthony P AP Walker John R JR Izpisúa Belmonte Juan Carlos JC Schultz Peter G PG

Nature chemical biology 20060212 3

The cyanobacterial metabolite apratoxin A (1) demonstrates potent cytotoxicity against tumor cell lines by a hitherto unknown mechanism. We have used functional genomics to elucidate the molecular basis for this activity. Gene expression profiling and DNA content analysis showed that apratoxin A induces G1-phase cell cycle arrest and apoptosis. Cell-based functional assays with a genome-wide collection of expression cDNAs showed that ectopic induction of fibroblast growth factor receptor (FGFR) ...[more]

PMID: 16474387

Similar Datasets

Genomic Strategies Identify the Antitumor Agent Apratoxin A as a Potent Antagonist of FGF Signaling and STAT3 Activation

Project description:Total RNA was extracted from apratoxin A or vehicle treated HT29 cells using the RNeasy Mini Kit (Qiagen). Probe values from CEL files were condensed to probe sets using Rosetta Resolver software. Resolver ANOVA analysis was then performed between groups. Keywords: time course and dose

2006-02-08 | GSE2742 | GEO

Ciprofibrate (PPAR-alpha agonist) in the monkey liver

Project description:Liver gene expression was examined in male cynomolgus monkeys treated with ciprofibrate (PPAR-alpha agonist) for 4 days at 400 mg/kg/day and treated for 15 days at 0, 3, 30, 150 or 400 mg/kg/day. The untreated control group were given only the vehicle (0.5% hydroxypropyl methylcellulose). Two animals per group were used for the 4 day treatment and four animals per group were used for the 15 day treatment (except the 15 day control group, which had three animals). Selection of significantly changed probesets was done using Rosetta Resolver and the fold-change and p values as determined by Resolver are given below. Affymetrix CEL files and MAS5-processed data have been made availabe for convenience. Note that data processing reported in the Toxicological Sciences manuscript was done using Rosetta Resolver and the treated versus control group fold-change and p-value are appended to the Series entry. An article has been published in Toxicological Sciences regarding this dataset; the data interpretation was based on the Rosetta Resolver data. Keywords: repeat

2005-08-23 | GSE2853 | GEO

Decline of Nucleotide Excision Repair Capacity in Aged Caenorhabditis elegans

Project description:We used gene expression profiling to address several specific questions that arose in a study of repair of ultraviolet C radiation in C elegans, as well as to generate hypotheses regarding the possible mechanism(s) of decreased DNA repair observed in old adults in that study. This analysis was performed in order to analyze gene expression in the strain (JK1107) and experimental conditions that we used for our DNA repair studies. The supplementary file GSE4766_Resolver_all_data.txt includes Resolver generated fold-changes and p values based on ratios built in Rosetta Resolver as described in the Rosetta Biosoftware Technical Note (Lee Weng, 2004), Data processing and analysis methods in the Rosetta Resolver system (http://www.rosettabio.com/tech/default.htm). Keywords: C elegans, glp-1, age, nucleotide excision repair, ultraviolet radiation, DNA damage

2007-05-16 | GSE4766 | GEO

Transcription profiling of liver samples from Macaca fascicularis treated with varying doses of ciprofibrate for 4 or 15 days

2007-07-22 | E-GEOD-2853 | biostudies-arrayexpress

HT29 and GATA6

Project description:HT29 and GATA6

| PRJNA263819 | ENA

Expression data from shROR HT29 and AGS cell

2015-06-05 | GSE67416 | GEO

LEAFY-GR time-course experiment in callus

Project description:Callus derived from 35S:LFY-GR plants was treated with dexamethasone- or was mock-treated for 0,2,4,6,8,10,12, or 22 hours. Four biologically independent sets of samples were generated and RNA probes derived from these samples were co-hybridized to a cDNA array enriched for flower-specific transcripts. The data were analyzed with Rosetta Resolver as described in Wagner et al. (2004). Keywords: time-course

2004-07-02 | GSE1411 | GEO

Transcription profiling of C. elegans treated with UV-C radiation

Project description:We used gene expression profiling to address several specific questions that arose in a study of repair of ultraviolet C radiation in C elegans, as well as to generate hypotheses regarding the possible mechanism(s) of decreased DNA repair observed in old adults in that study. This analysis was performed in order to analyze gene expression in the strain (JK1107) and experimental conditions that we used for our DNA repair studies. The supplementary file GSE4766_Resolver_all_data.txt includes Resolver generated fold-changes and p values based on ratios built in Rosetta Resolver as described in the Rosetta Biosoftware Technical Note (Lee Weng, 2004), Data processing and analysis methods in the Rosetta Resolver system (http://www.rosettabio.com/tech/default.htm). Experiment Overall Design: Gene expression data for glp-1 (strain JK1107) nematodes were obtained by comparing mRNA expression level in replicate pools of 2000-3000 mixed-stage embryos, young (1-day) adults, and old (6-day) adults raised at 25ÂºC. Three replicate pools of embryo and young adult samples were analyzed, but only two replicate pools of 6-day adults were analyzed due to low RNA recovery.

2008-06-13 | E-GEOD-4766 | biostudies-arrayexpress

Expression data from shROR HT29 and AGS cell

Project description:Genome-wide cDNA array from HT29,HT29-shROR,HT29-Mock, AGS, AGS-shROR, AGS-Mock cells We used microarrays to detail the global programme of gene expression and identified significantly changed genes after ROR depletion. HT29,HT29-shROR, HT29-Mock, AGS, AGS-shROR, AGS-Mock cells were selected for RNA extraction and hybridization on Affymetrix microarrays.

2015-06-05 | E-GEOD-67416 | biostudies-arrayexpress

Transcriptome expression changes after knockdown of ALDH1A1 in human colon cancer cells HT29

Project description:Firstly, shRNA (GCCAAATCATTCCTTGGAATT) was used to knock down ALDH1A1 in HT29 cells, and the knockdown effect was verified by western blot. Then the shALDH1A1 HT29 cells were compared with parental HT29 cells by RNA-seq.

2024-08-27 | GSE225822 | GEO

OmicsDI is part of the ELIXIR infrastructure

OmicsDI is an Elixir interoperability service. Learn more ›

Tweets

OmicsDI Databases

PRIDE
PeptideAtlas
MassIVE
JPOST Repository
Physiome Model Repository

EGA
EVA
ENA
LINCS
PAXDB
Cell Collective

MetaboLights
Metabolomics Workbench
MetabolomeExpress
GNPS
BioModels
FAIRDOMHub

ArrayExpress
dbGaP
ExpressionAtlas
GEO
NODE

Information

Databases
Help
API
Contact us
Code on GitHub
Terms of use
Submit Data