Browse
Submit Data
Databases
API
Help

Unknown,Transcriptomics,Genomics,Proteomics

Dataset Information

64 Views

0 Connections

0 Citations

0 Reanalyses

0 Downloads

Omics score: 0

Characterization of A. baumannii Mitomycin C (MMC) response

ABSTRACT: Transcriptional profiling of A. baumannii ATCC 17978 comparing treated-MMC cultures with non-MMC treated cultures Two-condition experiment A. baumannii 17978 MMC+ vs A. baumannii 17978 MMC-. Biological replicates:3, Technical replicates:2

ORGANISM(S): Acinetobacter baumannii ATCC 17978

SUBMITTER: JESUS ARANDA

PROVIDER: E-GEOD-44735 | biostudies-arrayexpress |

REPOSITORIES: biostudies-arrayexpress

ACCESS DATA

Json Xml

Publications

Identification of a DNA-damage-inducible regulon in Acinetobacter baumannii.

Aranda Jesús J Poza Margarita M Shingu-Vázquez Miguel M Cortés Pilar P Boyce John D JD Adler Ben B Barbé Jordi J Bou Germán G

Journal of bacteriology 20131011 24

The transcriptional response of Acinetobacter baumannii, a major cause of nosocomial infections, to the DNA-damaging agent mitomycin C (MMC) was studied using DNA microarray technology. Most of the 39 genes induced by MMC were related to either prophages or encoded proteins involved in DNA repair. Electrophoretic mobility shift assays demonstrated that the product of the A. baumannii MMC-inducible umuD gene (umuDAb) specifically binds to the palindromic sequence TTGAAAATGTAACTTTTTCAA present in ...[more]

PMID: 24123815

Similar Datasets

Characterization of A. baumannii Mitomycin C (MMC) response

Project description:Transcriptional profiling of A. baumannii ATCC 17978 comparing treated-MMC cultures with non-MMC treated cultures

2013-11-14 | GSE44735 | GEO

Comparison of the gene expression profiles of different strains of A. baumannii by microarrays

Project description:In the present work we compare the gene expression profile of A. baumannii and a mutant knock-out strain of A. baumannii lacking a small RNA gene 13573 and the corresponding small RNA 13573 over-producing strain. The main objective is to recognize the main pathways in which the small RNA 13573 is involved. Moreover, the same wild type strain was used to infect mice and was further analyzed after the infection with the aim of finding genes differentially expressed in vivo. Three biological replicates have been performed for each comparison. The RNA collection from Acinetobacter baumannii strain over-expresing the small RNA (sample 13573) was compared with this isolated from A. baumannii harboring the empty vector (PETRA sample) while gene expression in the knock-out strain (KO sample) was compared with the wild type strain Acinetobacter baumannii ATCC 17978 (ATCC sample). The RNA from A.baumannii recovered from the infected animals (INF sample) was compared with the wild type (ATCC).

2016-08-01 | E-GEOD-60348 | biostudies-arrayexpress

Genome-wide analysis of E.coli response to mitomycin (MMC) treatment in wild type and recN mutant

Project description:We report the role of recN in the induction of the sos response Examination of gene profiling at two time points after addition of mitomycin (MMC) at 10Âµg/ml

2016-04-01 | E-GEOD-74882 | biostudies-arrayexpress

Expression Data from Acinetobacter baumannii strain ATCC 17978 and isogenic lpsB mutant cells

Project description:lpsB encodes a glycosyltransferase involved in lipopolysaccharide (LPS) synthesis. LPS is a major component of the Gram-negative bacterial outer membranes. We used custom-made Affymetrix A. baumannii strain ATCC 17978 derived GeneChips to compare the gene expression properties of wild type and isogenic lpsB mutant cells. Two mutants were evaluated; A. baumannii strain 5A7 is a ATCC 17978 derivative harboring a transposon (Tn5) within lpsB (A1S_0430 locus); A. baumannii strain containing a deletion of lpsB (A1S_0430). A. baumannii strain ATCC 17978, 5A7 (lpsB:Tn5) or IH1∆lpsB (∆lpsB) were grown to mid-exponential phase growth, total bacterial RNA was isolated and subjected to GeneChip hybridization and analysis. We sought to determine the transcription profile of lpsB mutated cells.

2012-12-01 | E-GEOD-40771 | biostudies-arrayexpress

Transcriptomic analysis of chlorhexidine shock in Acinetobacter baumannii

Project description:In this study the transcriptomic changes occurring in A. baumannii ATCC 17978 in response to shock treament using the biocide chlorhexdine were determined. A. baumannii ATCC 17978 cells were grown at 37Â°C with shaking (200rpm) in 35mL cultures in MH broth to OD600=0.75, at which time they were split into 15mL cultures. One 15mL sample was treated with 4Âµg/mL chlorhexidine (0.5x MIC), whereas the other was not treated and used as a reference. Cultures were allowed to grow for a further 30 mins (to an average final OD600= ~1.35 for untreated cells and 1.25 for chlorhexidine treated samples), when cells were harvested by centrifugation and immediately suspended in Trizol reagent (Invitrogen). Total RNA was extracted using the PureLinkTM Micro-to-Midi Total RNA Purification kit (Invitrogen), incorporating an on-column DNAseI (Invitrogen) digestion. The experiment included using four grids of a custom Agilent 8 x 15000 spot microarray. Three biological replicates and one flip dye experiment.

2013-12-03 | E-GEOD-51525 | biostudies-arrayexpress

Transcription profiling by array of Fanconi Anemia patient (FANCA) EBV cell line transduced with control shRNA or a shRNA targeting p53 and treated with a Mitomycin C (MMC) pulse

Project description:Time point (H0, H24, H72) expression data from an EBV cell line obtained from a Fanconi Anemia patient (FANCA) transduced with a control shRNA (sh Ctrl) (n=3) or a shRNA targeting p53 (sh p53) (n=3) and treated with a brief MMC pulse.

2012-10-23 | E-MTAB-1099 | biostudies-arrayexpress

ChIP-Seq with anti-FLAG antibodies to determine binding of LexA-3xFLAG to DNA in Streptomyces venezuelae treated with Mitomycin C (MMC) overnight

Project description:LexA is a transcriptional repressor for genes requiring expression primarily during SOS response in response to stress such as that caused by DNA alkylating agent Mitomycin C (MMC). LexA undergoes self-cleavage under stress conditions thereby lifting the repression on genes whose expression is required for stress response. In our experiment LexA binding sites in the genome were determined in untreated and MMC treated (overnight, 14h) cultures using a LexA-3xFLAG strain and anti-FLAG monoclonal antibodies. Wild type Streptomyces venezuelae (unFLAGged LexA) cultures, with and without MMC treatment were used as negative controls.

2022-07-06 | E-MTAB-11603 | biostudies-arrayexpress

Transcriptional responses of Acinetobacter baumannii ATCC 17978 to limiting iron availability

Project description:A. baumannii ATCC 17978 cells were incubated under iron replete (mueller-hinton) and iron limiting (MH + 200 ÂµM 2,2'-dipyridyl) conditions, total RNA was extracted when cultures reached OD600=0.7. The probes on the microarray cover all predicted open reading frames (at least 4 per ORF) and additional replicates of housekeeping genes of the A. baumannii ATCC 17978 genome

2013-10-18 | E-GEOD-24921 | biostudies-arrayexpress

Deinococcus radiodurans R1 Cells was treated with MMC (5 M-NM-<g/ml) : Control treated with MMC (5 M-NM-<g/ml) vs. bphPR deletion mutant treated with MMC (5 M-NM-<g/ml)

Project description:Transcriptional profiling of Deinococcus radiodurans comparing control wild type cells with bphPR deletion mutant were treated with MMC (5 M-NM-<g/ml) Two-condition experiment, R1 MMC (5 M-NM-<g/ml) vs. bphPR deletion cell MMC (5 M-NM-<g/ml). Biological replicates: 3 control replicates, 3 bphPR deletion mutant replicates.

2014-07-07 | E-GEOD-59138 | biostudies-arrayexpress

An Ribonuclease T2 Family Protein Modulates Acinetobacter baumannii Abiotic Surface Colonization

Project description:A. baumannii has the propensity to colonize abiotic surfaces and this is thought to mediate its transmission to susceptible patients. We found that disruption of A. baumannii ribonuclease T2 family protein (ATCC 17978 locus A1S_3026) severely diminishes the organism's ability to colonize abiotic surfaces. We used Affymetrix A. baumannii GeneChips (part number PMDACBA1) to compare the gene expression properties of wild type and isogenic ribonuclease T2 family protein mutant cells. A. baumanni strain 98-37-09 (wild type) or isogenic ACJ7 (harboring a EZ-Tn5 insertion in A1S_3026) cells were grown to mid-exponential phase growth in Luria Burtani medium, total bacterial RNA was isolated and subjected to GeneChip hybridization and analysis. We sought to determine the regulatory effects of A1S_3026.

2014-01-01 | E-GEOD-52002 | biostudies-arrayexpress

OmicsDI is part of the ELIXIR infrastructure

OmicsDI is an Elixir interoperability service. Learn more ›

Tweets

OmicsDI Databases

PRIDE
PeptideAtlas
MassIVE
JPOST Repository
Physiome Model Repository

EGA
EVA
ENA
LINCS
PAXDB
Cell Collective

MetaboLights
Metabolomics Workbench
MetabolomeExpress
GNPS
BioModels
FAIRDOMHub

ArrayExpress
dbGaP
ExpressionAtlas
GEO
NODE

Information

Databases
Help
API
Contact us
Code on GitHub
Terms of use
Submit Data