Browse
Submit Data
Databases
API
Help

Unknown,Transcriptomics,Genomics,Proteomics

Dataset Information

0 Views

0 Connections

0 Citations

0 Reanalyses

0 Downloads

Omics score: 0

Gene expression signature overlap between shETV1 and BRD32048 in LNCaP and SK-MEL-28

ABSTRACT: Identification of BRD32048 as an inhibitor of ETV1 oncogenic transcription factor. This compound was indentified by small molecule mcroarray (a binding assay). It was able to consistently inhibit an ETV1-dependent MMP1-driven luciferase signal. Its direct binding was validated by Suface plasmon resonance (Biacore assay). It inhibits ETV1-driven invasion in ETV1-dependent cell lines. The goal of this gene expression comparison was to interogate the effects of BRD32048 on the global gene expression and to define the degree to which its siganture overlaps with an ETV1-specific shRNA-induced gene expression signature. The gene expression analysis was performed for two ETV1- dependent cell lines. (a) LNCaP (prostate cancer) uses a DOX-inducible system where two different ETV1sh (sh1117 and sh872) are induced for 4 days. In parallel cells were treated with 20 M-BM-5M BRD32048 for 16 hours. The control was DMSO treated cells. (b) SK-MEL-28 were infected with two different ETV1sh (sh3 and sh5) and selected in puromycin for 4 days. The sh control used was GFPsh. In parallel cells were treated with 20 M-BM-5M BRD32048 for 16 hours. The control was DMSO treated cells. Total RNA was isolated and measured with expression arrays. The data was normalized (see data processing) and the gene expression signatures (fold change >1.5 in either direction) were interested bteween the experimental conditions for each cell line.

ORGANISM(S): Homo sapiens

SUBMITTER: Marius Pop

PROVIDER: E-GEOD-52154 | biostudies-arrayexpress |

REPOSITORIES: biostudies-arrayexpress

ACCESS DATA

Json Xml

Similar Datasets

ASXL1 Knock Down in Normal CD34+ Cord Blood and UKE1 Cell Lines

Project description:Gene expression analysis of Normal CD34+ Cord Blood and UKE1 cell lines treated with hairpins targeting ASXL1. Two independent studies where 1) CD34+ cord blood from normal donors were treated with either A) GFP Vector or B) ASXL1 specific short hairpin and 2) UKE1 cell lines treated with either A) GFP Vector or B) ASXL1 specific short hairpin.

2012-08-21 | E-GEOD-38692 | biostudies-arrayexpress

Access to follicular dendritic cells is a pivotal step in murine chronic lymphocytic leukemia B cell activation and proliferation

Project description:In human chronic lymphocytic leukemia (CLL) pathogenesis B cell antigen receptor signaling seems important for leukemia B cell ontogeny, whereas the microenvironment influences B cell activation, tumor cell lodging and provision of antigenic stimuli. Using the murine E?-Tcl1 CLL model, we demonstrate that CXCR5-controlled access to follicular dendritic cells (FDCs) confers proliferative stimuli to leukemia B cells. Intravital imaging revealed a marginal zone B cell-like leukemia cell trafficking route. Murine and human CLL cells reciprocally stimulated resident mesenchymal stromal cells through lymphotoxin-?-receptor activation, resulting in CXCL13 secretion and stromal compartment remodeling. Inhibition of lymphotoxin/lymphotoxin-?-receptor signaling or of CXCR5 signaling retards leukemia progression. Thus, CXCR5 activity links tumor cell homing, shaping a survival niche, and access to localized proliferation stimuli. This GEO dataset is comprised of GEP measurements for EµTCL mouse CD5+CD19+ tumor cells and healthy WT controls, including healthy MZB cells and B1 cells. 6 measurements are for WT EµTCL1 mice, 5 for the CXCR5-KO EµTCL1 genotype. MZB and B1 cells were pooled from 15 animals. WT reference was obtained from 5 WT animals

2014-09-01 | E-GEOD-60925 | biostudies-arrayexpress

JAK2 Naive and Persitent Murine BaF3 cells infected with MPLW515L

Project description:Transcriptional profiling of Murine BaF3 cells infected with MPLW515L grown under either normal conditions (Naive) or in 0.8 uM INCB18424 for 4-6 weeks (Persistent). Naive and Persistent cells were then treated with either DMSO (Control) or 0.8 uM INCB18424 for 4 hours. Goal was to determine transcriptional changes conditioned upon sensitivity/resistance of BaF3 MPLW515L mutants to JAK1/2 specific inhibitor. 3 condition experiment consiting of: 1) Naive cells treated with DMSO (Control) , 2) Naïve cells treated with 0.8 uM INCB18424 for 4 hours (Acute) and 3) Persistent cells treated with 0.8 uM INCB18424 for 4 hours (Persistent). Biological replicates: 3 DMSO control replicates, 3 Acute replicates, 3 Persistent replicates.

2012-05-30 | E-GEOD-38335 | biostudies-arrayexpress

Expression profiling of human prostate VCaP and LNCaP cancer cells after silencing ERG or ETV1, respectively

Project description:Chromosomal rearrangements involving ETS factors, ERG and ETV1, occur frequently in prostate cancer. We here examine human prostate cancer cells control VCaP and LNCaP cells with ERG- or ETV1-silenced VCaP or LNCaP cells, respectively, in hormone deprived and stimulated conditions. VCAP and LNCaP cells, 24 hr after ERG or ETV1 RNA interference, respectively, were grown in hormone-depleted conditions for 2 days, and then in the presence of EtOH (vehicle) or 10nM DHT for 16hr. Total RNA was extracted from three biological replicates. This was used to hybridize to Affymetrix expression arrays using the HG-U133 Plus 2.0 platform.

2013-03-01 | E-GEOD-39354 | biostudies-arrayexpress

PTEN loss deM-oM-,M-^Anes a PI3K/AKT pathway-dependent germinal center subtype of diffuse large B-cell lymphoma

Project description:Diffuse large B-cell lymphoma (DLBCL) represents a heterogeneous diagnostic category with distinct molecular subtypes that can be deM-oM-,M-^Aned by gene expression proM-oM-,M-^Aling. However, even within these deM-oM-,M-^Aned subtypes, heterogeneity prevails. To further elucidate the pathogenesis of these entities, we determined the expression of the tumor suppressor phosphatase and tensin homolog (PTEN) in 248 primary DLBCL patient samples. These analyses revealed that loss of PTEN was detectable in 55% of germinal center B-cell-like (GCB) DLBCLs, whereas this abnormality was found in only 14% of non-GCB DLBCL patient samples. In GCB DLBCL, the PTEN status was inversely correlated with activation of the oncogenic PI3K/ protein kinase B (AKT) pathway in both DLBCL cell lines and primary patient samples. Reexpression of PTEN induced cytotox- icity in PTEN-deM-oM-,M-^Acient GCB DLBCL cell line models by inhibiting PI3K/AKT signaling, indicating an addiction to this pathway in this subset of GCB DLBCLs. PI3K/AKT inhibition induced down-regulation of the transcription factor MYC. Reexpression of MYC rescued GCB DLBCL cells from PTEN-induced toxicity, identifying a regulatory mechanism of MYC expression in DLBCL. Finally, pharmacologic PI3K inhibition resulted in toxicity selectively in PTEN-deM-oM-,M-^Acient GCB DLBCL lines. Collectively, our results indicate that PTEN loss deM-oM-,M-^Anes a PI3K/ AKT-dependent GCB DLBCL subtype that is addicted to PI3K and MYC signaling and suggest that pharmacologic inhibition of PI3K might represent a promising therapeutic approach in these lymphomas. This GEO dataset is comprised of a) GEP measurements for 34 primary DLBCL patient samples plus two reference samples, b) 8 paired GEP measurements of the HT DLBCL cell line and c) aCGH measurements for two DLBCL cell lines in addition to previously published cell lines in GSE43272 (i.e., Sample GSM1059798). All of these data were used in the paper cited below.

2013-07-09 | E-GEOD-45495 | biostudies-arrayexpress

Growth signals employ CGGBP1 to suppress transcription of Alu-SINEs [Affymetrix]

Project description:Alu SINEs are the most numerous frequently occurring transcription units in our genome and possess sequence competence for transcription by RNA Pol III. However, through poorly understood mechanisms, the Alu RNA levels are maintained at very low levels in normal somatic cells with obvious benefits of low rates of Alu retrotransposition and energy-economical deployment of RNA Pol III to the tRNA genes which share promoter structure and polymerase requirements with Alu SINEs. Using comparative ChIP sequencing, we unveil that a repeat binding protein, CGGBP1, binds to the transcriptional regulatory regions of Alu SINEs thereby impeding Alu transcription by inhibiting RNA Pol III recruitment. We show that this Alu-silencing depends on growth factor stimulation of cells and subsequent tyrosine phosphorylation of CGGBP1. Importantly, CGGBP1 ensures a sequence-specific discriminative inhibition of RNA Pol III activity at Alu promoters, while sparing the structurally similar tRNA promoters. Our data suggest that CGGBP1 contributes to growth-related transcription by preventing the hijacking of RNA Pol III by Alu SINEs. This study was used to find out the effect of CGGBP1 on serum-induced changes in gene expression and effect of serum on gene expression regulation by CGGBP1. Gene expression profiling of normal human fibroblasts under 4 different experimental perturbations: serum starvation or serum stimulation and CGGBP1 depletion or normal CGGBP1 levels.

2015-12-21 | E-GEOD-54058 | biostudies-arrayexpress

Gene expression profile of ETV1 knockdown in LNCaP prostate cancer cells

Project description:Over half of prostate cancer harbor overexpression of ETS transcription factors including ERG and ETV1. LNCaP prostate cancer cells have an ETV1 translocation to the MIPOL1 locus on 14q13.3-13q21.1. To determine genes regulated by ETV1, we performed shRNA mediated knockdown of ETV1 using two lentiviral constructs as well as a scrambled shRNA in triplicate. Two pLKO.1 constructs against ETV1 (ETV1sh1: TRCN0000013923, targeting GTGGGAGTAATCTAAACATTT in 3'(B UTR; and ETV1sh2: TRCN0000013925, targeting CGACCCAGTGTATGAACACAA in exon 7) were purchased from Open Biosystems and pLKO.1 shScr (targeting CCTAAGGTTAAGTCGCCCTCG) was purchased from Addgene. RNA was harvested 3 days after infection and gene expression profiling was performed. Among genes downregulated were many well characterized androgen regulated genes. LNCaP cells logarthmically growing in full serum was infected with three different shRNA lentiviruses. Three days after infection

2013-05-10 | E-GEOD-46329 | biostudies-arrayexpress

Gene expression profiling of prostate cancer cells upon JMJD2A or ETV1 knockdown

Project description:Gene expression profiling of LNCaP prostate cancer cells that have JMJD2A knockdown (JMJD2A shRNA #3; JMJD2A shRNA #5) or ETV knockdown (ETV shRNA #1; ETC shRNA #5) were compared to non-targeted control (sh-cm) cells. Total RNA was isolated from transformed LNCaP human prostate cancer cells containing a non-trageting control vector (sh-cm), vectors containing shRNA sequences for JMJD2A or ETV1 genes.

2014-01-01 | E-GEOD-47750 | biostudies-arrayexpress

ETV1 knockdown in GIST cell lines

Project description:ETV1 is highly expressed in GIST cells and required for their survival and growth. To identify genes and pathways regulated by ETV1 in GIST, we performed expression profiles of GIST cells after ETV1 knockdown. Two GIST cell lines (GIST48 and GIST882) were infected in duplicate with three shRNA viruses (Scrambled, ETV1sh1-B11TRCN0000013923, ETV1sh2-TRCN0000013925). Four days after infection, RNA was harvested for expression profiling.

2010-10-13 | E-GEOD-19396 | biostudies-arrayexpress

The effect of CSF1-Fc treatment in pigs on liver gene expression

Project description:The expression was designed to determine whether exposure to CSF1-Fc has any effect on liver-specific gene expression in pigs. livers from pigs exposed to CSF1-Fc

2016-08-01 | E-GEOD-78837 | biostudies-arrayexpress

OmicsDI is part of the ELIXIR infrastructure

OmicsDI is an Elixir interoperability service. Learn more ›

Tweets

OmicsDI Databases

PRIDE
PeptideAtlas
MassIVE
JPOST Repository
Physiome Model Repository

EGA
EVA
ENA
LINCS
PAXDB
Cell Collective

MetaboLights
Metabolomics Workbench
MetabolomeExpress
GNPS
BioModels
FAIRDOMHub

ArrayExpress
dbGaP
ExpressionAtlas
GEO
NODE

Information

Databases
Help
API
Contact us
Code on GitHub
Terms of use
Submit Data