Browse
Submit Data
Databases
API
Help

Unknown,Transcriptomics,Genomics,Proteomics

Dataset Information

0 Views

0 Connections

0 Citations

0 Reanalyses

0 Downloads

Omics score: 0

ETV1 knockdown in GIST cell lines

ABSTRACT: ETV1 is highly expressed in GIST cells and required for their survival and growth. To identify genes and pathways regulated by ETV1 in GIST, we performed expression profiles of GIST cells after ETV1 knockdown. Two GIST cell lines (GIST48 and GIST882) were infected in duplicate with three shRNA viruses (Scrambled, ETV1sh1-B11TRCN0000013923, ETV1sh2-TRCN0000013925). Four days after infection, RNA was harvested for expression profiling.

ORGANISM(S): Homo sapiens

SUBMITTER: Ping Chi

PROVIDER: E-GEOD-19396 | biostudies-arrayexpress |

REPOSITORIES: biostudies-arrayexpress

ACCESS DATA

Json Xml

Publications

ETV1 is a lineage survival factor that cooperates with KIT in gastrointestinal stromal tumours.

Chi Ping P Chen Yu Y Zhang Lei L Guo Xingyi X Wongvipat John J Shamu Tambudzai T Fletcher Jonathan A JA Dewell Scott S Maki Robert G RG Zheng Deyou D Antonescu Cristina R CR Allis C David CD Sawyers Charles L CL

Nature 20101003 7317

Gastrointestinal stromal tumour (GIST) is the most common human sarcoma and is primarily defined by activating mutations in the KIT or PDGFRA receptor tyrosine kinases. KIT is highly expressed in interstitial cells of Cajal (ICCs)-the presumed cell of origin for GIST-as well as in haematopoietic stem cells, melanocytes, mast cells and germ cells. Yet, families harbouring germline activating KIT mutations and mice with knock-in Kit mutations almost exclusively develop ICC hyperplasia and GIST, su ...[more]

PMID: 20927104

Similar Datasets

Gastrointestinal stromal tumor GIST: gene expresssion and ChIP analyses

Project description:This SuperSeries is composed of the following subset Series: GSE19396: ETV1 knockdown in GIST cell lines GSE22433: Imatinib Treatment of GIST882 GSE22441: Mapping of ETV1 genomic binding sites in gastrointestinal stromal tumor (GIST). Refer to individual Series

2010-10-14 | E-GEOD-22852 | biostudies-arrayexpress

Imatinib Treatment of GIST882

Project description:Gastrointestinal Stromal Tumor frequently harbor mutations in the KIT receptor tyrosine kinase and depend on its activity for growth. This underlies the efficacy of imatinib, a inhibitor of KIT activity, in GIST management. GIST882 is a patient derived GIST cell line that harbor a K640E exon 13 KIT mutation and is sensitive to imatinib treatment. To analyze the downstream effect of KIT inhibition, GIST882 cells were treated for 8 hours with 1Î¼M Imatinib. GIST882 cells were treated in triplicate with 0.1% DMSO or 1Î¼M Imatinib for 8 hours. RNA was isolated and analyzed by Illumina Human HT-12 beadarray.

2010-10-13 | E-GEOD-22433 | biostudies-arrayexpress

Gene expression profile of ETV1 knockdown in LNCaP prostate cancer cells

Project description:Over half of prostate cancer harbor overexpression of ETS transcription factors including ERG and ETV1. LNCaP prostate cancer cells have an ETV1 translocation to the MIPOL1 locus on 14q13.3-13q21.1. To determine genes regulated by ETV1, we performed shRNA mediated knockdown of ETV1 using two lentiviral constructs as well as a scrambled shRNA in triplicate. Two pLKO.1 constructs against ETV1 (ETV1sh1: TRCN0000013923, targeting GTGGGAGTAATCTAAACATTT in 3'(B UTR; and ETV1sh2: TRCN0000013925, targeting CGACCCAGTGTATGAACACAA in exon 7) were purchased from Open Biosystems and pLKO.1 shScr (targeting CCTAAGGTTAAGTCGCCCTCG) was purchased from Addgene. RNA was harvested 3 days after infection and gene expression profiling was performed. Among genes downregulated were many well characterized androgen regulated genes. LNCaP cells logarthmically growing in full serum was infected with three different shRNA lentiviruses. Three days after infection

2013-05-10 | E-GEOD-46329 | biostudies-arrayexpress

RNA-Seq of murine GIST-like tumors after Etv1 ablation

Project description:We used a mouse expressing three alleles 1) KitV558Delta/+ activating allele that develop GIST-like tumors in the cecum, 2) Etv1 flox/flox conditional knockout allele and 3) Rosa26-CreERT2 tamoxifen activated Cre allele. Mice were treated with either Tamoxifen (to delete Etv1) or corn oil (control). Cecal tumors were isolated for gene expression profiling by RNA-Seq. Expression profile mouse cecal GIST tumor with or without Etv1 ablation was generated by RNA-Seq

2015-01-01 | E-GEOD-64608 | biostudies-arrayexpress

ETV1 knockdown in GIST cell lines

Project description:ETV1 is highly expressed in GIST cells and required for their survival and growth. To identify genes and pathways regulated by ETV1 in GIST, we performed expression profiles of GIST cells after ETV1 knockdown.

2010-10-13 | GSE19396 | GEO

Mapping of ETV1 genomic binding sites in gastrointestinal stromal tumor (GIST).

2010-10-14 | GSE22441 | GEO

ETV1 binding sites in GIST and Melanoma cells

Project description:ETV1 is an oncogene in GIST and melanoma and a downstream transcriptional effector of MAP kinase signaling. Here, mapped the ETV1 binding sites in GIST and melanoma cell lines using ChIP-seq.

2018-04-15 | GSE80443 | GEO

Mapping of ETV1 genomic binding sites in gastrointestinal stromal tumor (GIST).

Project description:ETV1 is highly expressed in GIST and their presumed precursors--the interstitial cells of Cajal. ETV1 is required for survival for both GIST and ICC and regulates GIST signature genes. Here, using Illumina-Solexa based next-generation sequencing of ETV1 chromatin immunoprecipates (ChIP-Seq), we define ETV1 binding sites in the GIST48 cell line. Crosslinked ChIP using input control ETV1 ChIP in GIST48 cells. Details: GIST48 cells were crosslinked for 15-minutes in 1% parformaldehyde. Cells were lysed and chromatin sheared using bioruptor. Sheared chromatin was incubated with anti-rabbit IgG dynabeads pre-conjugated with anti-ETV1 antibody (Abcam Ab81086, Lot 787879), washed, eluted, reverse cross-linked, and purified. Purified ChIP DNA was blunt-ended, ligated to Solexa adaptors, amplified with 18-cycles of PCR, and sequenced on Solexa Genome Analyzer. All reads (~36-bp) from ChIP-Seq were aligned to the human genome (build 36, or hg18) using the ELAND alignment software within the Illumina Analysis Pipeline. Unique reads mapped to a single best-matching location with no more than two mismatches were kept and used to generate genome-wide distribution of ETV1-binding and for peak identification. Redundant reads were considered once.

2010-10-14 | E-GEOD-22441 | biostudies-arrayexpress

RNA-Seq of murine GIST-like tumors after Etv1 ablation

2015-01-01 | GSE64608 | GEO

Effect of ETV1 knockdown on genome wide AR binding in LNCaP Cells

Project description:Translocation of ETS transcription factors including ERG and ETV1 occur in half of all prostate cancers. LNCaP cells harbor an ETV1 translocation. We performed ChIP-Seq analysis to determine the role of ETV1 on AR binding. The localization of enhancers were determined by H3K4me1 ChIP-Seq. To determine ETV1 and H3K4me1 localization, logarithmically growing cells

2013-06-13 | E-GEOD-47120 | biostudies-arrayexpress

OmicsDI is part of the ELIXIR infrastructure

OmicsDI is an Elixir interoperability service. Learn more ›

Tweets

OmicsDI Databases

PRIDE
PeptideAtlas
MassIVE
JPOST Repository
Physiome Model Repository

EGA
EVA
ENA
LINCS
PAXDB
Cell Collective

MetaboLights
Metabolomics Workbench
MetabolomeExpress
GNPS
BioModels
FAIRDOMHub

ArrayExpress
dbGaP
ExpressionAtlas
GEO
NODE

Information

Databases
Help
API
Contact us
Code on GitHub
Terms of use
Submit Data