Unknown,Transcriptomics,Genomics,Proteomics

Dataset Information

Expression data from Control or ShSuz12 rat Intestinal epithelial cells IEC-6

ABSTRACT: Polycomb-group proteins form multimeric protein complexes involved in transcriptional silencing. The Polycomb Repressive complex 2 (PRC2) contains the Suppressor of Zeste-12 protein (Suz12) and the histone methyltransferase Enhancer of Zeste protein-2 (Ezh2). This complex, catalyzing the di- and tri-methylation of histone H3 lysine 27, is essential for embryonic development and stem cell renewal. However, the role of Polycomb-group protein complexes in the control of the intestinal epithelial cell (IEC) phenotype is not known. We investigated the impact of Suz 12 depletion on gene expression in IEC-6 cells. Multiple shRNA lentiviral constructs were tested in IEC-6 cells for their ability to down-regulate Suz12 expression (MISSION shRNA lentiviral transduction particles, SigmaM-bM-^@M-^SAldrich Canada, Oakville, ON). Forty percent confluent cells were infected in medium supplemented with 4 mg/ml polybrene (SigmaM-bM-^@M-^SAldrich Canada) for 6 h. Two days after infection, cell populations were selected with 2 mg/ml puromycin (SigmaM-bM-^@M-^SAldrich Canada). The clone TRCN0000038728 was selected: the shRNA against Suz12 (GCTGACAATCAAATGAATCAT) is conserved in rat (accession number FM084383), murine (accession number NM_199196) and human (accession number NM_015355.2) Suz12 sequences. Efficiency of infection was estimated at 25%. Control or ShSuz12 IEC-6 cell total RNAs were isolated with the Rneasy kit (Qiagen, Mississauga, ON, Canada), according to the manufacturerM-bM-^@M-^Ys instructions. RNA samples from three independent experiments were used for microarray analysis.

ORGANISM(S): Rattus norvegicus

SUBMITTER: Claude Asselin

PROVIDER: E-GEOD-60003 | biostudies-arrayexpress |

REPOSITORIES: biostudies-arrayexpress

ACCESS DATA

Publications

The histone H3K27 methylation mark regulates intestinal epithelial cell density-dependent proliferation and the inflammatory response.

Turgeon Naomie N Blais Mylène M Delabre Jean-François JF Asselin Claude C

Journal of cellular biochemistry 20130501 5

Polycomb-group proteins form multimeric protein complexes involved in transcriptional silencing. The Polycomb Repressive complex 2 (PRC2) contains the Suppressor of Zeste-12 protein (Suz12) and the histone methyltransferase Enhancer of Zeste protein-2 (Ezh2). This complex, catalyzing the di- and tri-methylation of histone H3 lysine 27, is essential for embryonic development and stem cell renewal. However, the role of Polycomb-group protein complexes in the control of the intestinal epithelial ce ...[more]

PMID: 23192652

Similar Datasets

Project description:Histone deacetylases (Hdac) remove acetyl groups from proteins, influencing global and specific gene expression. Hdacs control inflammation, as shown by Hdac inhibitor-dependent protection from DSS-induced murine colitis. While tissue-specific Hdac knockouts show redundant and specific functions, little is known of their intestinal epithelial cell (IEC) role. We have shown previously that dual Hdac1/Hdac2 IEC-specific loss disrupts cell proliferation and determination, with decreased secretory cell numbers and altered barrier function. We thus investigated how compound Hdac1/Hdac2 or Hdac2 IEC-specific deficiency alters the inflammatory response. Floxed Hdac1 and Hdac2 and villin-Cre mice were interbred. Compound Hdac1/Hdac2 IEC-deficient mice showed chronic basal inflammation, with increased basal Disease Activity Index (DAI) and deregulated Reg gene colonic expression. DSS-treated dual Hdac1/Hdac2 IEC-deficient mice displayed increased DAI, histological score, intestinal permeability and inflammatory gene expression. In contrast to double knockouts, Hdac2 IEC-specific loss did not affect IEC determination and growth, nor result in chronic inflammation. However, Hdac2 disruption protected against DSS colitis, as shown by decreased DAI, intestinal permeability and caspase-3 cleavage. Hdac2 IEC-specific deficient mice displayed increased expression of IEC gene subsets, such as colonic antimicrobial Reg3b and Reg3g mRNAs, and decreased expression of immune cell function-related genes. Our data show that Hdac1 and Hdac2 are essential IEC homeostasis regulators. IEC-specific Hdac1 and Hdac2 may act as epigenetic sensors and transmitters of environmental cues and regulate IEC-mediated mucosal homeostatic and inflammatory responses. Different levels of IEC Hdac activity may lead to positive or negative outcomes on intestinal homeostasis during inflammation Total RNAs from the colon of three control and three Hdac2 IEC-specific knockout mice were isolated with the Rneasy kit (Qiagen, Mississauga, ON, Canada).

Project description:Background The implication of post-transcriptional regulation by microRNAs in molecular mechanisms underlying cancer disease is well documented. However, their interference at the cellular level is not fully explored. Functional in vitro studies are fundamental for the comprehension of their role; nevertheless results are highly dependable on the adopted cellular model. Next generation small RNA transcriptomic sequencing data of a tumor cell line and keratinocytes derived from primary culture was generated in order to characterize the microRNA content of these systems, thus helping in their understanding. Both constitute cell models for functional studies of microRNAs in head and neck squamous cell carcinoma (HNSCC), a smoking-related cancer. Known microRNAs were quantified and analyzed in the context of gene regulation. New microRNAs were investigated using similarity and structural search, ab initio classification, and prediction of the location of mature microRNAs within would-be precursor sequences. Results were compared with small RNA transcriptomic sequences from HNSCC samples in order to access the applicability of these cell models for cancer phenotype comprehension and for novel molecule discovery. Results Ten miRNAs represented over 70% of the mature molecules present in each of the cell types. The most expressed molecules were miR-21, miR-24 and miR-205, Accordingly; miR-21 and miR-205 have been previously shown to play a role in epithelial cell biology. Although miR-21 has been implicated in cancer development, and evaluated as a biomarker in HNSCC progression, no significant expression differences were seen between cell types. We demonstrate that differentially expressed mature miRNAs target cell cycle progression and apoptosis related biological processes, indicating that they might represent, with acceptable accuracy, the genetic context from which they derive. Most miRNAs identified in the cancer cell line and in keratinocytes were present in tumor samples and cancer-free samples, respectively, with miR-21, miR-24 and miR-205 still among the most prevalent molecules at all instances. Thirteen miRNA-like structures, containing reads identified by the deep sequencing, were predicted from putative miRNA precursor sequences. Strong evidences suggest that one of them could be a new miRNA. This molecule was mostly expressed in the tumor cell line and HNSCC samples indicating a possible biological function in cancer. Conclusions Critical biological features of cells must be fully understood before they can be chosen as models for functional studies. Expression levels of miRNAs relate to cell type and tissue context. This study provides insights on miRNA content of two cell models used for cancer research. Pathways commonly deregulated in HNSCC were targeted by most expressed and also by differentially expressed miRNAs. Results indicate that the use of cell models for cancer research demands careful assessment of underlying molecular characteristics for proper data interpretation. Additionally, one new miRNA-like molecule with a potential role in cancer was identified in the cell lines and clinical samples. This submission represents the gene expression component of the study only Microarray analysis was performed using Agilent Whole Human Genome Microarray 4M-CM-^W44K arrays and labeled using the One Color Quick Amp Labeling Kit (Agilent Technologies). A total of four samples were analyzed: two biological replicates of SCC25 and two biological replicates of normal keratinocytes. Hybridization and washing followed protocols described by the manufacturer (Agilent Technologies). The one-color arrays were scanned by GenePix 4000B Scanner (Axon), and analyzed using the Agilent Feature extraction software (version 9.5). The quality control of the microarrays was assessed using the standard Agilent controls to verify that the arrays met the expected criteria.

Project description:Mantle cell lymphoma (MCL) is an aggressive B-cell non-HodgkinM-bM-^@M-^Ys lymphoma (NHL). In cancers, tumour suppressive microRNAs may be silenced by DNA hypermethylation. By microRNA profiling, miR-155-3p was significantly upregulated upon demethylation treatment of MCL cell lines with 5-aza-2M-bM-^@M-^Y-deoxycytidine (5-azadC). Methylation-specific PCR, verified by pyrosequencing, showed complete methylation of miR-155-3p in one MCL cell line (REC-1). 5-azadC treatment of REC-1 led to demethylation and re-expression of miR-155-3p. Over-expression of miR-155-3p led to increased sub-G1 apoptotic cells and reduced cellular viability, demonstrating its tumour suppressive properties. By luciferase assay, lymphotoxin-beta (LT-M-NM-2) was validated as a miR-155-3p target. In 31 primary MCL, miR-155-3p was found hypermethylated in 6(19%) cases. To test if methylation of miR-155-3p was MCL-specific, miR-155-3p methylation was tested in an additional 191 B-cell, T-cell and NK-cell NHLs, yielding miR-155-3p methylation in 66(34.6%) including 36(27%) non-MCL B-cell, 24(53%) T-cell and 6(46%) of NK-cell lymphoma. Moreover, in 72 primary NHL samples with RNA, miR-155-3p methylation correlated with miR-155-3p downregulation (p=0.030), and LT-M-NM-2 upregulation (p=0.004). Collectively, miR-155-3p is tumour suppressive microRNA hypermethylated in MCL and other NHL subtypes. As miR-155-3p targets LT-M-NM-2, which is an upstream activator of the non-canonical NF-kB signalling, miR-155-3p methylation is potentially important in lymphomagenesis Total RNA isolated from MINO and JEKO-1 before and after 5-azadC treatment were converted into cDNA by MegaplexTM RT Primers and TaqManM-BM-. MicroRNA Reverse Transcription Kit. cDNA was pre-amplified using MegaplexTM PreAmp Primer and loaded onto 384-well format TaqmanM-BM-. human microRNA array A V2.0 & B V3.0. Real-time PCR was performed on 7900HT Real-Time PCR system and raw data were analyzed normalizing to mean of three endogenous controls (U6snRNA, RNU44 and RNU48). Relative microRNA levels were determined by M-NM-^TM-NM-^TCt using endogenous controls and untreated controls using SDS 2.4 and RQ manager 1.2. All experimental procedures and analyses were performed according to manufacturerM-bM-^@M-^Ys instruction, using reagents, system and softwares acquired from Applied Biosystems (Foster City, USA).

Dataset Information

Expression data from Control or ShSuz12 rat Intestinal epithelial cells IEC-6

Publications

The histone H3K27 methylation mark regulates intestinal epithelial cell density-dependent proliferation and the inflammatory response.

Similar Datasets

OmicsDI is part of the ELIXIR infrastructure

Tweets