Unknown,Transcriptomics,Genomics,Proteomics

Dataset Information

CRISPR Display: A modular method for locus-specific targeting of long noncoding RNAs and synthetic RNA devices in vivo [RNA-Seq]

ABSTRACT: Noncoding RNAs (ncRNAs) comprise an important class of natural regulators that mediate a vast array of biological processes, including the modulation of chromatin architecture. Moreover, artificial ncRNAs have revealed that the functional capabilities of RNA are extremely broad. To further investigate and harness these capabilities, we developed CRISPR-Display ("CRISP-Disp"), a targeted localization strategy that uses Cas9 to deploy large RNA cargos to specific DNA loci. We demonstrate that exogenous RNA domains can be functionally appended onto the CRISPR scaffold at multiple insertion points, allowing the construction of Cas9 complexes with RNAs nearing one kilobase in length, with structured RNAs, protein-binding cassettes, artificial aptamers and pools of random sequences. CRISP-Disp also allows the simultaneous multiplexing of disparate functions at multiple targets. We anticipate that this technology will provide a powerful method with which to ectopically localize functional RNAs and ribonuceloprotein complexes at specified genomic loci. Whole cell poly(A) selected RNA seq, from HEK293FT cells bearing lentivirally-integrated Gaussia and Cypridina luciferase reporter loci. Cells were transiently transfected with dCas9~VP64 alone, or with dCas9~VP and one of several modified sgRNAs,each targeting the Gaussia reporter.

ORGANISM(S): Homo sapiens

SUBMITTER: Scott Younger

PROVIDER: E-GEOD-66755 | biostudies-arrayexpress |

REPOSITORIES: biostudies-arrayexpress

ACCESS DATA

Similar Datasets

Project description:Clustered regularly interspaced short palindromic repeat (CRISPR) RNA-guided nucleases have gathered considerable excitement as a tool for genome engineering. However, questions remain about the specificity of their target site recognition. Most previous studies have examined predicted off-target binding sites that differ from the perfect target site by one to four mismatches, which represent only a subset of genomic regions. Here, we used ChIP-seq to examine genome-wide CRISPR binding specificity at gRNA-specific and gRNA-independent sites. For two guide RNAs targeting the murine Snurf gene promoter, we observed very high binding specificity at the intended target site while off-target binding was observed at 2- to 6-fold lower intensities. We also identified significant gRNA-independent off-target binding. Interestingly, we found that these regions are highly enriched in the PAM site, a sequence required for target site recognition by CRISPR. To determine the relationship between Cas9 binding and endonuclease activity, we used targeted sequence capture as a high-throughput approach to survey a large number of the potential off-target sites identified by ChIP-seq or computational prediction. A high frequency of indels was observed at both target sites and one off-target site, while no cleavage activity could be detected at other ChIP-bound regions. Our results demonstrate that even a simple configuration of a Cas9:gRNA nuclease can support very specific DNA cleavage activity and that most interactions between the CRISPR nuclease complex and genomic PAM sites do not lead to DNA cleavage. ChIP-seq using dCas9 to determine genome-wide binding of CRISPR/Cas9 noED: Cas9 doublemutant protein without an effector domain KRAB: Cas9 doublemutant protein fused to the KRAB repressor domain S1 gRNA: guide RNA targeting GCTCCCTACGCATGCGTCCC(AGG) in the mouse genome S2 gRNA: guide RNA targeting AATGGCTCAGGTTTGTCGCG(CGG) in the mouse genome VEGFA TS3 gRNA: guide RNA targeting GGTGAGTGAGTGTGTGCGTG(TGG) in the human genome

Dataset Information

CRISPR Display: A modular method for locus-specific targeting of long noncoding RNAs and synthetic RNA devices in vivo [RNA-Seq]

Similar Datasets

OmicsDI is part of the ELIXIR infrastructure

Tweets