Browse
Submit Data
Databases
API
Help

Unknown,Transcriptomics,Genomics,Proteomics

Dataset Information

36 Views

0 Connections

0 Citations

0 Reanalyses

0 Downloads

Omics score: 0

A fully validated blood stem/progenitor cell regulatory network reveals mechanisms of cell state stabilisation

ABSTRACT: The aim of this study was to determine the genomic binding sites of important haematopoietic transcription factors in haematopoietic cell lines. 416Bs cells were fixed with either 1 or 0.4 % formaldehyde for 10 mins. Chromatin was isolated, sonicated for 7 mins (30 sec on, 30 sec off), and specific antibodies were used to pull down the transcription factors of interest after a pre-clearing step. Chromatin was washed, de-crosslinked, amplified, size selected by gel purification and sequenced.

ORGANISM(S): Mus musculus

SUBMITTER: Rebecca Hannah

PROVIDER: E-GEOD-69776 | biostudies-arrayexpress |

REPOSITORIES: biostudies-arrayexpress

ACCESS DATA

Json Xml

Publications

An experimentally validated network of nine haematopoietic transcription factors reveals mechanisms of cell state stability.

Schütte Judith J Wang Huange H Antoniou Stella S Jarratt Andrew A Wilson Nicola K NK Riepsaame Joey J Calero-Nieto Fernando J FJ Moignard Victoria V Basilico Silvia S Kinston Sarah J SJ Hannah Rebecca L RL Chan Mun Chiang MC Nürnberg Sylvia T ST Ouwehand Willem H WH Bonzanni Nicola N de Bruijn Marella Ftr MF Göttgens Berthold B

eLife 20160222

Transcription factor (TF) networks determine cell-type identity by establishing and maintaining lineage-specific expression profiles, yet reconstruction of mammalian regulatory network models has been hampered by a lack of comprehensive functional validation of regulatory interactions. Here, we report comprehensive ChIP-Seq, transgenic and reporter gene experimental data that have allowed us to construct an experimentally validated regulatory network model for haematopoietic stem/progenitor cell ...[more]

PMID: 26901438

Similar Datasets

Cytokine-mediated differentiation reflects genome-wide loss of a uSTAT transcriptional program

Project description:uSTAT transcriptional program HPC7 cells were fixed with either 1% formaldehyde for 10 mins. Chromatin was isolated, sonicated for 7 mins (30 sec on, 30 sec off), and specific antibodies were used to pull down the transcription factors of insterest after a pre-clearing step. Chromatin was washed, de-crosslinked, amplified, size selected by gel purification and sequenced.

2016-01-05 | E-GEOD-70697 | biostudies-arrayexpress

Single-cell analyses of regulatory network perturbations using enhancer-targeting TALEs suggest novel roles for PU.1 during haematopoietic specification

Project description:The aim of this study was to determine the genomic binding sites of an HA-tagged Transcription Activator-Like Effector (TALE) fused to a VP64 domain with a DNA binding domain designed to bind the sequence GGGCGCTTCCTGTTTTCTCA (found in the PU.1-14kb enhancer element in mouse and human genome), termed HA-T-VP64-PU.1-14, in the 416B mouse myeloid progenitor cell line. Inducible T-VP64-PU.1-14 transgene contained within the piggyBac vector was stably integrated into 416B cells by transfection along with a constituteively expressed rtTA plasmid (pCAG-rtTA-piggyBac) and a piggyBac transposase. 416Bs carrying stably integrated transgenes were FACS sorted based on their ability to expressed the transgene and expanded before HA-T-VP64-PU.1-14 expression was induced for 48 hours by addition of dox before cells were fixed with 1% formaldehyde for 10 mins. Chromatin was isolated, sonicated for 7 mins (30 sec on, 30 sec off), and an anti-HA antibody used to pull down the HA-T-VP64-PU.1-14 after a pre-clearing step. Chromatin was washed, de-crosslinked, amplified, size selected by gel purification and sequenced. As a control, untransfected 416B cells were similarly ChIP'd.

2014-11-05 | E-GEOD-61189 | biostudies-arrayexpress

Transcriptional binding patterns involved in promoter-enhancer interactions.

Project description:This study was designed to be able to determine the interactions between promoter and enhancer elements in the haematopoietic stem/progenitor cell line HPC-7. The next step was to investigate if specific transcription factors could be associated with looping events and to determine if there was co-operative binding involved.

2016-02-29 | E-MTAB-3954 | biostudies-arrayexpress

The transcriptional program controlled by Runx1 during early hematopoietic development (ChIP-seq data)

Project description:Transcription factors have long been recognised as powerful regulators of mammalian development, yet it is largely unknown how individual key regulators operate within wider regulatory networks. Here we have used a combination of global gene expression and chromatin-immunoprecipitation approaches across four ES-cell-derived populations of increasing haematopoietic potential to define the transcriptional programme controlled by Runx1, an essential regulator of blood cell specification. Integrated analysis of these complementary genome-wide datasets allowed us to construct a global regulatory network model, which suggested that core regulatory circuits are activated sequentially during blood specification, but will ultimately collaborate to control many haematopoietically expressed genes. Using the CD41/integrin alpha 2b gene as a model, cellular and in vivo studies showed that CD41 is controlled by both early and late circuits in fully specified blood cells, but initiation of CD41 expression critically depends on a later subcircuit driven by Runx1. Taken together, this study represents the first global analysis of the transcriptional programme controlled by any key haematopoietic regulator during the process of early blood cell specification. Moreover, the concept of interplay between sequentially deployed core regulatory circuits is likely to represent a design principle widely applicable to the transcriptional control of mammalian development. 4 samples: 3 samples of Runx1 transcription factor ChIP from the Runx1+/VE-cadherin+/CD41+ population, Runx1+/VE-cadherin+/CD41- population and Runx1+/VE-cadherin-/CD41+ population, and 1 Control (IgG).

2012-05-30 | E-GEOD-29514 | biostudies-arrayexpress

A fully validated blood stem/progenitor cell regulatory network reveals mechanisms of cell state stabilisation

Project description:The aim of this study was to determine the genomic binding sites of important haematopoietic transcription factors in haematopoietic cell lines.

2016-03-17 | GSE69776 | GEO

Identification of early gibberellin (GA) responsive genes in Arabidopsis hypocotyls

Project description:The aim of the experiment was to identify early gibberellin (GA) responsive genes in the roots of an Arabidopsis GA deficient mutant.The GA deficient mutant used in this study is a transgenic line overexpressing the PcGA2ox1 gene. This mutant has an identical phenotype to ga1-3, but it does not require exogenous GA treatment for germination.Seeds were germinated on 1xMS + 1% (w/v) sucrose plates containing 0.7% gelrite, and grown under continous light. The plates were orientated vertically.After six days growth the plates were treated with or without 5uM GA4 for 0, 30, 60 and 180 minutes.Approximately 400 hypocotyls were harvested per timepoint using a razorblade and after excision the hypocotyls were frozen in liquid nitrogen giving a total of 7 experimental samples (1: untreated, 2: 30 mins GA4, 3: 30 mins untreated, 4: 60 mins GA4, 5: 60 mins untreated, 6: 180 mins GA4, 7: 180 mins untreated. Three biological replicates were performed giving a total of 21 root samples. Total RNA was isolated from the roots using the QIAGEN RNeasy method. Keywords: Expression profiling by array

2009-11-18 | GSE18985 | GEO

Genome-scale analysis in blood progenitor and mast cells reveals how lineage-affiliated transcription factors control distinct regulatory programs [ChIP-Seq/RNA-Seq Experiments]

Project description:Despite major advances in the generation of genome-wide binding maps, the mechanisms by which transcription factors (TFs) regulate cell type identity have remained largely obscure. Through comparative analysis of 10 key haematopoietic TFs in both mast cells and blood progenitors, we demonstrate that the largely cell-type specific binding profiles are not opportunistic, but instead contribute to cell-type specific transcriptional control, because (1) mathematical modelling of differential binding of shared TFs can explain differential gene expression, (2) cell-type specific binding is largely mediated through consensus binding sites, and (3) knock-down of blood stem cell regulators Gata2 and Erg in mast cells reveals mast cell specific genes as direct targets. Finally we show that the known mast cell regulators Mitf and c-Fos likely contribute to the global reorganisation of TF binding profiles. Taken together therefore, our study elucidates how key regulatory TFs contribute to transcriptional programmes in several distinct mammalian cell types. Comparison of HPC7 cell line (haematopoietic multipotent progenitor) and primary mast cells. 10 key haematopoietic transcription factors and mRNA expression were profiled in both cell types.

2014-04-24 | E-GEOD-48085 | biostudies-arrayexpress

The transcriptional program controlled by Runx1 during early hematopoietic development

Project description:This SuperSeries is composed of the following subset Series: GSE29112: The transcriptional program controlled by Runx1 during early hematopoietic development (expression data) GSE29514: The transcriptional program controlled by Runx1 during early hematopoietic development (ChIP-seq data) Refer to individual Series

2012-05-30 | E-GEOD-29515 | biostudies-arrayexpress

Primary peri-aorta adipose tissue stromal vascular fraction single cell RNA sequencing

Project description:Peri-aorta adipose tissue were digested with collagense I (2mg/ml) at 37 C for 30 mins

2019-06-12 | GSE132581 | GEO

Amyloids from WT and mstr C. elegans

Project description:200,000 worms were grown to the young adult stage, collected, and washed. Worms were homogenized in lysis buffer (10mM Tris, pH 7.5, 138mM NaCl, 2mM CaCl2, and 0.1% NP-40). After homogenization, 125U/mL Benzonase nuclease was added to homogenates and samples were incubated for 30 mins at room temperature with gentle rocking. Samples were spun at 21,000g for 5 mins, followed by resuspension of the pellet in lysis buffer. Soluble proteins were removed from the pellet with repeated washes in lysis buffer until A280 of the supernatant was equal to A280 of lysis buffer. Resulting pellet was resuspended in ddH2O, spun at 21,000g for 5 mins, and supernatant was transferred to a collection tube. Water resuspensions and recoveries were continued until A280 of H2O supernatants was 0. Recovered water washes were pooled and amyloids salted out by adding NaCl to 200mM final concentration, followed by 1-3 days incubation at 4oC. Precipitated amyloids were recovered by centrifuging at 21,000g for 30 mins, followed by resuspension in 50-100uL ddH2O. Amyloids were digested (trypsin and chymotrypsin) and prepared for mass spectrometry as described in the methods files.

2024-07-09 | PXD043926 | Pride

OmicsDI is part of the ELIXIR infrastructure

OmicsDI is an Elixir interoperability service. Learn more ›

Tweets

OmicsDI Databases

PRIDE
PeptideAtlas
MassIVE
JPOST Repository
Physiome Model Repository

EGA
EVA
ENA
LINCS
PAXDB
Cell Collective

MetaboLights
Metabolomics Workbench
MetabolomeExpress
GNPS
BioModels
FAIRDOMHub

ArrayExpress
dbGaP
ExpressionAtlas
GEO
NODE

Information

Databases
Help
API
Contact us
Code on GitHub
Terms of use
Submit Data