Browse
Submit Data
Databases
API
Help

Unknown,Transcriptomics,Genomics,Proteomics

Dataset Information

39 Views

0 Connections

0 Citations

0 Reanalyses

0 Downloads

Omics score: 0

Cytokine-mediated differentiation reflects genome-wide loss of a uSTAT transcriptional program

ABSTRACT: uSTAT transcriptional program HPC7 cells were fixed with either 1% formaldehyde for 10 mins. Chromatin was isolated, sonicated for 7 mins (30 sec on, 30 sec off), and specific antibodies were used to pull down the transcription factors of insterest after a pre-clearing step. Chromatin was washed, de-crosslinked, amplified, size selected by gel purification and sequenced.

ORGANISM(S): Mus musculus

SUBMITTER: Rebecca Hannah

PROVIDER: E-GEOD-70697 | biostudies-arrayexpress |

REPOSITORIES: biostudies-arrayexpress

ACCESS DATA

Json Xml

Publications

Cytokine-induced megakaryocytic differentiation is regulated by genome-wide loss of a uSTAT transcriptional program.

Park Hyun Jung HJ Li Juan J Hannah Rebecca R Biddie Simon S Leal-Cervantes Ana I AI Kirschner Kristina K Flores Santa Cruz David D Sexl Veronika V Göttgens Berthold B Green Anthony R AR

The EMBO journal 20151223 6

Metazoan development is regulated by transcriptional networks, which must respond to extracellular cues including cytokines. The JAK/STAT pathway is a highly conserved regulatory module, activated by many cytokines, in which tyrosine-phosphorylated STATs (pSTATs) function as transcription factors. However, the mechanisms by which STAT activation modulates lineage-affiliated transcriptional programs are unclear. We demonstrate that in the absence of thrombopoietin (TPO), tyrosine-unphosphorylated ...[more]

PMID: 26702099

Similar Datasets

A fully validated blood stem/progenitor cell regulatory network reveals mechanisms of cell state stabilisation

Project description:The aim of this study was to determine the genomic binding sites of important haematopoietic transcription factors in haematopoietic cell lines. 416Bs cells were fixed with either 1 or 0.4 % formaldehyde for 10 mins. Chromatin was isolated, sonicated for 7 mins (30 sec on, 30 sec off), and specific antibodies were used to pull down the transcription factors of interest after a pre-clearing step. Chromatin was washed, de-crosslinked, amplified, size selected by gel purification and sequenced.

2016-03-17 | E-GEOD-69776 | biostudies-arrayexpress

Single-cell analyses of regulatory network perturbations using enhancer-targeting TALEs suggest novel roles for PU.1 during haematopoietic specification

Project description:The aim of this study was to determine the genomic binding sites of an HA-tagged Transcription Activator-Like Effector (TALE) fused to a VP64 domain with a DNA binding domain designed to bind the sequence GGGCGCTTCCTGTTTTCTCA (found in the PU.1-14kb enhancer element in mouse and human genome), termed HA-T-VP64-PU.1-14, in the 416B mouse myeloid progenitor cell line. Inducible T-VP64-PU.1-14 transgene contained within the piggyBac vector was stably integrated into 416B cells by transfection along with a constituteively expressed rtTA plasmid (pCAG-rtTA-piggyBac) and a piggyBac transposase. 416Bs carrying stably integrated transgenes were FACS sorted based on their ability to expressed the transgene and expanded before HA-T-VP64-PU.1-14 expression was induced for 48 hours by addition of dox before cells were fixed with 1% formaldehyde for 10 mins. Chromatin was isolated, sonicated for 7 mins (30 sec on, 30 sec off), and an anti-HA antibody used to pull down the HA-T-VP64-PU.1-14 after a pre-clearing step. Chromatin was washed, de-crosslinked, amplified, size selected by gel purification and sequenced. As a control, untransfected 416B cells were similarly ChIP'd.

2014-11-05 | E-GEOD-61189 | biostudies-arrayexpress

Transcriptional binding patterns involved in promoter-enhancer interactions.

Project description:This study was designed to be able to determine the interactions between promoter and enhancer elements in the haematopoietic stem/progenitor cell line HPC-7. The next step was to investigate if specific transcription factors could be associated with looping events and to determine if there was co-operative binding involved.

2016-02-29 | E-MTAB-3954 | biostudies-arrayexpress

Comprehensive Epigenomic Analysis Reveals Dynamic Regulatory Programs Of Blood Development (TF ChIP-seq)

Project description:Embryonic hematopoiesis is regulated by the coordinated interaction between transcription factors and the epigenetic regulators driving developmental-stage specific gene expression but how this process drives hematopoietic specification and terminal differentiation is poorly understood. Here we generated RNA-Seq, DNase-Seq and ChIP-Seq data for histone marks and transcription factors from ES-cell derived purified cells representing six sequential stages of blood cell specification and differentiation. Our data reveal the binding patterns of specific transcription factors involved in the priming and maintenance of distal elements and inform how binding impacts on promoter activity. Functional studies based on these data uncovered a previously unrecognised role for Hippo signalling in mammalian hematopoietic specification. Finally, we present a dynamic core regulatory network model for hematopoiesis and demonstrate its utility for the design of reprogramming experiments. Our study represents a powerful resource for studying hematopoiesis and demonstrates how such data can advance our understanding of mammalian development. ChIP-seq data of histone modifications and transcription factors, and RNA-seq data obtained from purified cells representing five sequential stages of murine blood cell specification and differentiation

2016-02-26 | E-GEOD-69099 | biostudies-arrayexpress

Identification of early gibberellin (GA) responsive genes in Arabidopsis hypocotyls

Project description:The aim of the experiment was to identify early gibberellin (GA) responsive genes in the roots of an Arabidopsis GA deficient mutant.The GA deficient mutant used in this study is a transgenic line overexpressing the PcGA2ox1 gene. This mutant has an identical phenotype to ga1-3, but it does not require exogenous GA treatment for germination.Seeds were germinated on 1xMS + 1% (w/v) sucrose plates containing 0.7% gelrite, and grown under continous light. The plates were orientated vertically.After six days growth the plates were treated with or without 5uM GA4 for 0, 30, 60 and 180 minutes.Approximately 400 hypocotyls were harvested per timepoint using a razorblade and after excision the hypocotyls were frozen in liquid nitrogen giving a total of 7 experimental samples (1: untreated, 2: 30 mins GA4, 3: 30 mins untreated, 4: 60 mins GA4, 5: 60 mins untreated, 6: 180 mins GA4, 7: 180 mins untreated. Three biological replicates were performed giving a total of 21 root samples. Total RNA was isolated from the roots using the QIAGEN RNeasy method. Keywords: Expression profiling by array

2009-11-18 | GSE18985 | GEO

A functional map of DNA-associated proteolysis

Project description:We established an assay to localize DNA-associated proteins that are slated for degradation by the ubiquitin-proteasome system. The genome-wide map we describe here ties proteolysis to active enhancer elements and to transcription start sites of specific gene families. ChIP-sequencing of ubiquitin and transcription factors was performed in the presence or absence of proteasome inhibition.

2013-12-01 | E-GEOD-33821 | biostudies-arrayexpress

The transcriptional program controlled by Runx1 during early hematopoietic development (ChIP-seq data)

Project description:Transcription factors have long been recognised as powerful regulators of mammalian development, yet it is largely unknown how individual key regulators operate within wider regulatory networks. Here we have used a combination of global gene expression and chromatin-immunoprecipitation approaches across four ES-cell-derived populations of increasing haematopoietic potential to define the transcriptional programme controlled by Runx1, an essential regulator of blood cell specification. Integrated analysis of these complementary genome-wide datasets allowed us to construct a global regulatory network model, which suggested that core regulatory circuits are activated sequentially during blood specification, but will ultimately collaborate to control many haematopoietically expressed genes. Using the CD41/integrin alpha 2b gene as a model, cellular and in vivo studies showed that CD41 is controlled by both early and late circuits in fully specified blood cells, but initiation of CD41 expression critically depends on a later subcircuit driven by Runx1. Taken together, this study represents the first global analysis of the transcriptional programme controlled by any key haematopoietic regulator during the process of early blood cell specification. Moreover, the concept of interplay between sequentially deployed core regulatory circuits is likely to represent a design principle widely applicable to the transcriptional control of mammalian development. 4 samples: 3 samples of Runx1 transcription factor ChIP from the Runx1+/VE-cadherin+/CD41+ population, Runx1+/VE-cadherin+/CD41- population and Runx1+/VE-cadherin-/CD41+ population, and 1 Control (IgG).

2012-05-30 | E-GEOD-29514 | biostudies-arrayexpress

Primary peri-aorta adipose tissue stromal vascular fraction single cell RNA sequencing

Project description:Peri-aorta adipose tissue were digested with collagense I (2mg/ml) at 37 C for 30 mins

2019-06-12 | GSE132581 | GEO

Three distinct patterns of histone H3Y41 phosphorylation mark active genes

Project description:The aim of the project was to identify the global distribution of H3Y41ph and correlate its presence with the transcription factor STAT5 and the active histone modification H3K4me3. This was done in human erythroid leukaemia cells (HEL). HEL cells were treated with DMSO or a JAK2 inhibitor (TG101209) for 4 hours they were then crosslinked with formaldehyde and Chromatin immunoprecipitation was performed using antibodies against the proteins of interest. The DNA was then sequenced on the solexa platform. The analysis includes 7 samples: (1) H3Y41ph with DMSO, (2) H3Y41ph with TG101209, (3) STAT5 with DMSO, (4) STAT5 with TG101209, (5) IgG with DMSO, (6) H3K4me3 with DMSO, (7) independent replicate with H3Y41ph in DMSO

2013-04-15 | E-MTAB-1096 | biostudies-arrayexpress

Amyloids from WT and mstr C. elegans

Project description:200,000 worms were grown to the young adult stage, collected, and washed. Worms were homogenized in lysis buffer (10mM Tris, pH 7.5, 138mM NaCl, 2mM CaCl2, and 0.1% NP-40). After homogenization, 125U/mL Benzonase nuclease was added to homogenates and samples were incubated for 30 mins at room temperature with gentle rocking. Samples were spun at 21,000g for 5 mins, followed by resuspension of the pellet in lysis buffer. Soluble proteins were removed from the pellet with repeated washes in lysis buffer until A280 of the supernatant was equal to A280 of lysis buffer. Resulting pellet was resuspended in ddH2O, spun at 21,000g for 5 mins, and supernatant was transferred to a collection tube. Water resuspensions and recoveries were continued until A280 of H2O supernatants was 0. Recovered water washes were pooled and amyloids salted out by adding NaCl to 200mM final concentration, followed by 1-3 days incubation at 4oC. Precipitated amyloids were recovered by centrifuging at 21,000g for 30 mins, followed by resuspension in 50-100uL ddH2O. Amyloids were digested (trypsin and chymotrypsin) and prepared for mass spectrometry as described in the methods files.

2024-07-09 | PXD043926 | Pride

OmicsDI is part of the ELIXIR infrastructure

OmicsDI is an Elixir interoperability service. Learn more ›

OmicsDI Databases

PRIDE
PeptideAtlas
MassIVE
JPOST Repository
Physiome Model Repository

EGA
EVA
ENA
LINCS
PAXDB
Cell Collective

MetaboLights
Metabolomics Workbench
MetabolomeExpress
GNPS
BioModels
FAIRDOMHub

ArrayExpress
dbGaP
ExpressionAtlas
GEO
NODE

Information

Databases
Help
API
Contact us
Code on GitHub
Terms of use
Submit Data