Expression data from Jurkat cells treated with SB225002 for 6h and 9h.
Ontology highlight
ABSTRACT:
ORGANISM(S): Homo sapiens
SUBMITTER: Jaira Vasconcellos
PROVIDER: E-GEOD-71212 | biostudies-arrayexpress |
REPOSITORIES: biostudies-arrayexpress
Similar Datasets
Project description:In our efforts to evaluate the function of the IL-8 receptor CXCR2 in Acute Lymphoblastic Leukemia (ALL) cells, we made use of SB225002 (N-(2-hydroxy-4-nitrophenyl)-N’-(2-bromophenyl)urea), a drug initially described as a CXCR2 antagonist. Although the CXCR2 receptor was found to be non-functional in ALL, B- and T-ALL cell lines were sensitive to SB225002. We used microarray analysis to identify a transcriptional profile of genes that mediate SB225002's effects in acute lymphoblastic leukemia cells.
2015-07-23 | GSE71212 | GEO
Project description:RNA was extracted from the diagnostic bone marrow specimens of 50 T-cell acute lymphoblastic leukemia pediatric patients and analysed by Affymetrix microarray to model gene classifiers predictive of clinical outcome
2012-07-06 | E-MTAB-1205 | biostudies-arrayexpress
Project description:Understanding toxicity pathways of engineered nanomaterials (ENM) has recently been brought forward as a key step in 21st century ENM risk assessment. Molecular mechanisms linked to phenotypic end points is a step towards the development of toxicity tests based on key events, which may allow for grouping of ENM according to their mechanisms of action. This study identified molecular mechanisms underlying mitochondrial dysfunction in human bronchial epithelial BEAS 2B cells following exposure to one of the most studied multi-walled carbon nanotubes (MWCNTs; Mitsui-7). Asbestos was used as a positive control and a non-carcinogenic glass wool material was included as a negative fibre control. Decreased mitochondrial membrane potential (MMP↓) was observed for MWCNTs at a biologically relevant dose (0.25 μg/cm2) and for asbestos at 2 μg/cm2, but not for glass wool. Extensive temporal transcriptomic and microRNA expression analyses identified a 330-gene signature related to MWCNT- and asbestos-induced MMP↓. Fourty-nine of the MMP↓-associated genes showed highly similar expression patterns over time (six time points) and the majority was found to be regulated by two transcription factors strongly involved in mitochondrial homeostasis, APP and NRF1. In addition, four miRNAs were associated with MMP↓ and one of them, miR-1275, was found to negatively correlate with a large part of the MMP↓-associated genes. Cellular processes such as gluconeogenesis, glucose metabolism, mitochondrial LC-fatty acid β-oxidation and spindle microtubule function were enriched among the MMP↓-associated genes and miRNAs. These results are expected to be useful in the identification of key events in ENM-related toxicity pathways for the development of molecular screening techniques. BEAS 2B cells were exposed to 0.25 and 2 μg/cm2 of MWCNT, asbestos and glass wool (MMVF10) for 1, 4, 6, 12, 24 and 48 hours. Three independent experiments were performed to obtain a total of 3 replicates for each experimental condition. Non-exposed cells for each time point were used as controls. Three samples failed to give adequate quality RNA and a total of 123 samples were hybridized to Affymetrix GeneChip U133 Plus 24-array plates.
2015-04-02 | E-GEOD-63552 | biostudies-arrayexpress
Project description:T-cell acute lymphoblastic leukemia (T-ALL) and lymphoma (T-LBL) share common morphologic and immunophenotypic features and are treated with similar therapeutic approaches. Nonetheless, they show distinct clinical presentations suggesting that they may represent two different biological entities. In order to investigate T-LBL and T-ALL biological characteristics we used transcriptional profiling approache. Genome-wide gene expression profiling, performed on 20 T-LBL and 10 T-ALL diagnostic specimens, showed that the two malignancies shared a large fraction of their transcriptional profile while a subset of genes appeared to be differentially expressed in T-LBL versus T-ALL. This gene signature included genes involved in chemotactic responses and angiogenesis which might play a role in the different tumor cell localization suggesting that T-LBL and T-ALL could be two distinct diseases with unique transcriptional characteristics. diagnostic bone marrow aspirates from 10 T-ALL and 6 common-ALL pediatric patients and tumor biopsies from 20 T-LBL pediatric patients were analyzed by gene expression profiling
2012-05-31 | E-GEOD-29986 | biostudies-arrayexpress
Project description:The main goal of the research was to find some new biomarkers for the monitoring of the Minimal Residual Disease in Acute Lymphoblastic Leukemia patients. Experiment Overall Design: Lymphocytes from the Periferical Blood Samples of 11 patients with Acute Lymphoblastic Leukemia were purified according to lineage defined by the immunofenotype. The total RNA from the 11 samples were processed according to manufacturerâ??s instructions (Affymetrix, Inc., Santa Clara, CA). The batch .CEL files generated by GeneChip Operating Software (GCOS) were analyzed into R software with the affy module from the Bioconductor consortium. Samples with technical replicates were normalized applying the Quantile Normalization method. Then all the data were globally normalized applying the Loess Normalization Altorithm. Finally the gene expression differences were calculated.
2008-04-05 | E-GEOD-10820 | biostudies-arrayexpress
Project description:Background. The cAMP Response Element Binding Protein, CREB, is a transcription factor that regulates cell proliferation, differentiation, and survival in several model systems, including neuronal and hematopoietic cells. We demonstrated that CREB is overexpressed in acute myeloid and leukemia cells compared to normal hematopoietic stem cells. CREB knockdown inhibits leukemic cell proliferation in vitro and in vivo, but does not affect long-term hematopoietic reconstitution. Therefore, we propose CREB to be a potential target for therapy. To understand downstream pathways regulating CREB, we performed expression profiling with RNA from the K562 myeloid leukemia cell line. Results. By combining our expression data from CREB knockdown cells with prior ChIP data on CREB binding we were able to identify a list of putative CREB regulated genes. We performed extensive analyses on the top genes in this list as high confidence CREB targets. We found that this list is enriched for genes involved in cancer, and unexpectedly, highly enriched for histone genes. Furthermore, histone genes regulated by CREB were more likely to be specifically expressed in hematopoietic lineages. The transcription factor Elk-1 was upregulated in response to CREB deletion. Conclusions. We have identified a high confidence list of CREB targets in K562 cells. These genes allow us to begin to understand the mechanisms by which CREB contributes to acute leukemia. In particular, we speculate that the regulation of histone genes may play an important role in this process, by possibly altering the regulation of DNA replication during the cell cycle. Experiment Overall Design: Cell lines. The following human leukemia cell lines were transduced with shRNAs: K562 (Iscoves + 10% FCS) and TF-1 (RPMI + 10%FCS + rhGM-CSF. Cells were cultured at 37oC, 5% CO2 and split every 3 to 4 days. Primary AML bone marrow samples were processed as previously described [12]. All human samples were obtained with approval from the Institutional Review Board and consents were signed, according to the Helsinki protocol. Experiment Overall Design: shRNA sequence design and constructs. The CREB specific shRNA sequences were selected and validated based on accepted parameters established by Tuschl et al. [25-27]; CREB shRNA-1, CREB shRNA-2, CREB shRNA-3. Controls included empty vector, luciferase shRNA, and scrambled shRNA. shRNA sequences are: CREB shRNA-1(5âGCAAATGACAGTTCAAGCCC3â), shRNA-2 (5âGTACAGCTGGCTAACAATGG3â), shRNA-3 (5âGAGAGAGGTCCGTCTAATG3â), Luciferase shRNA (5âGCCATTCTATCCTCTAGAGGA3â), Scramble shRNA (5âGGACGAACCTGCTGAGATAT3â). Short-hairpin sequences were synthesized as oligonucleotides and annealed according to standard protocol. Annealed shRNAs were then subcloned into pSICO-R shRNA vectors from the Jacks laboratory at MIT [28]. The second generation SIN vector HIV-CSCG was used to produce human shRNA vectors [29]. Experiment Overall Design: Microarray analysis. Total RNA (10 μg) was extracted from K562 cells transduced with vector alone or CREB shRNA was submitted to the UCLA DNA Microarray Facility. RNA samples were labeled and hybridized by standard protocol to Affymetrix GeneChip Human Genome U133+ Array Set HG-U133A array. Gene expression values were calculated using the MAS5 software. The expression values are quantile normalized across all arrays. We obtained the expression profiles for a control set and CREB downregulated K562 cells. These are first quantile normalized, and then a t-test is performed between the two groups to identify significantly differentially regulated genes. The analysis was performed using Matlab (Mathworks, Inc.). A normal quantile plot of T is shown in figure qqplot.tiff. Data points with t-scores < 1/(2N) display with red circles, were N is the total number of genes. We therefore see that there are a significant number of differentially expressed genes, which are either direct or indirect targets of CREB.
2008-10-25 | E-GEOD-12056 | biostudies-arrayexpress
Project description:This SuperSeries is composed of the SubSeries listed below. Refer to individual Series
2015-04-02 | E-GEOD-63580 | biostudies-arrayexpress
Project description:We compared the expression of genes related to inflammatory cytotoxic functions between MSI and MSS (HLA class I negative and positive) gastrointestinal adenocarcinomas (GIACs), seeking evidence of differences in inflammatory mediators and cytotoxic T-cell responses. Twenty-two GIACs were divided into three study groups as a function of HLA class I expression and MSI phenotype. Comparison between eight high-level MSI (MSI-H) and 8 MSS/HLA+ (control) cancers identified 2170 differentially expressed genes (p< 0.05) after microarray analysis on the Affymetrix HG-U133-Plus-PM plate. We grouped genes in Gene Ontology functional categories: apoptotic programme (119 genes, p=5.1·10-7), leukocyte activation (32 genes, p=0.01), T cell activation (20 genes, p= 0.01), and cytokine production (19 genes, p= 0.04). Real-time RT-PCR and immunohistochemical evaluation were used to confirm some microarray data, finding that increased mRNA levels of pro-inflammatory cytokines and cytotoxic mediators were associated with greater infiltration by CD8+ T lymphocytes in the MSI-H group (p<0.001). Finally, tumours with immunohistochemical HLA class I negative pattern were not grouped together but rather in accordance with features of the gene expression profile of MSI or MSS tumours. As expected, genes associated with antigen processing machinery and MHC class I molecules (TAP2, B2m) were downregulated in MSS/HLA-ABC negative CRCs. In conclusion, microarray and immunohistochemical data may be useful to comprehensively assess tumour-host interactions and differentiate MSI from MSS cancers. The two types of tumours, MSI/HLA- and MSS/HLA-, showed marked differences in the composition and intensity of infiltrating leukocytes, suggesting that their immune escape strategies involve distinct pathways. Case-control study. Samples were selected according to immunological criteria: those with total loss of HLA antigens and those without alterations in the expression of HLA molecules. In addition, the microsatellite instability genotype of all the samples was also analyzed, resulting in microsatellite stability (MSS) and microsatellite instability (MSI) samples. Therefore, three groups of samples were selected: MSS/HLA+, MSS/HLA-, and MSI. The MSS/HLA+ group was used as the control.
2011-02-28 | E-GEOD-27544 | biostudies-arrayexpress
Project description:Gene expression profiling (GEP) can reveal characteristic signatures associated with distinct biologic subtypes of acute lymphoblastic leukemia (ALL). We performed GEP on Down syndrome (DS) and comparison non-Down syndrome (NDS) ALL cases to identify biologic differences between these groups. Ficoll-enriched, cryopreserved diagnostic bone marrow samples were obtained from patients with newly diagnosed B-precursor acute lymphoblastic leukemia.
2011-07-12 | E-GEOD-20910 | biostudies-arrayexpress
Project description:Pediatric acute lymphoblastic leukemia (ALL) contains cytogenetically distinct subtypes that respond differently to cytotoxic drugs. Subtype classification can be also achieved through gene expression profiling. However, how to apply such classifiers to a single patient and correctly diagnose the disease subtype in an independent patient group has not been addressed. Furthermore, the underlying regulatory mechanisms responsible for the subtype-specific gene expression patterns are still largely unknown. Here, by combining three published microarray datasets (PMIDs: 12086872, 12730115, 17002788) on 535 Caucasian samples and generating a new dataset on 100 Chinese children ALL samples, we were able to 1) identify a 62-gene classifier with 97.6% accuracy from the Caucasian samples and validated it on the completely independent set of 100 Chinese samples, 2) to uncover potential regulatory networks of ALL subtypes. The classifier we identified was so far the only one that could be applied directly to a single sample and sustained validation in a large independent patient group. Our results also suggest that the etiology of ALL is largely the same among different ethnic groups, and that the transcription factor hubs in the predicted regulatory network might play important roles in regulating gene expression and development of ALL. A total of 100 Chinese pediatric acute lymphoblastic leukemia bone marrow (BM) samples were analyzed, together with five non-ALL BM samples as negative control (the five samples were combined to generate one control, see details in Li et al. Blood, 2009). The diagnosis of ALL was based on morphology, immunology, cytogenetic and molecular (MICM) classification. Cytogenetic ALL subtypes were identified experimentally by G-banding karyotype and multiplex nested RT-PCR. Among the 100 ALL patients, eleven relapsed within five years. All the samples, including those relapsed afterward, were from patients treated on BCH-2003 protocol and were extracted at their initial diagnosis. The five non-ALL BM samples were taken from the removed bones of patients who had plastic surgery for their bone deformity in Beijing Children’s Hospital. And the informed consent was obtained from parents, guardians, or patients (as appropriate). More details are available in Li et al. Gene expression-based classification and regulatory networks of pediatric acute lymphoblastic leukemia, Blood, 2009. We have generated these ALL and control samples to validate that a high accuracy subtype classifier that we identified could be applied directly to a single sample and sustained validation in a large independent patient group.
2009-08-19 | E-GEOD-17703 | biostudies-arrayexpress