Targeting the SIN3A-PF1 Interaction inhibits Epithelial to Mesenchymal Transition and Maintenance of a Stem Cell Phenotype in Triple Negative Breast Cancer
Ontology highlight
ABSTRACT:
ORGANISM(S): Homo sapiens
SUBMITTER: Kevin Petrie
PROVIDER: E-GEOD-73871 | biostudies-arrayexpress |
REPOSITORIES: biostudies-arrayexpress
Similar Datasets
Project description:Triple negative breast cancer (TNBC) is characterized by a poorly differentiated phenotype and limited treatment options. Aberrant epigenetics in this subtype represent a potential therapeutic opportunity, but a better understanding of the mechanisms contributing to the TNBC pathogenesis is required. The SIN3 molecular scaffold performs a critical role in multiple cellular processes, including epigenetic regulation, and has been identified as a potential therapeutic target. Using a competitive peptide corresponding to the SIN3 interaction domain of MAD (Tat-SID), we investigated the functional consequences of selectively blocking the paired amphipathic helix (PAH2) domain of SIN3. Here, we report the identification of the SID-containing adaptor PF1 as a factor required for maintenance of the TNBC stem cell phenotype and epithelial to mesenchymal transition (EMT). Tat-SID peptide blocked the interaction between SIN3A and PF1, leading to epigenetic modulation and transcriptional downregulation of TNBC stem cell and EMT markers. Importantly, Tat-SID treatment led to a reduction in primary tumor growth and disseminated metastatic disease in vivo. In support of these findings, knockdown of PF1 expression phenocopied treatment with Tat-SID both in vitro and in vivo. These results demonstrate a critical role for a complex containing SIN3A and PF1 in TNBC and provide a rational for its therapeutic targeting. Mononucleosomes from MDA-MB-231 cells were isolated and ChIP with H3K4me3 antibody. DNA from Input and ChIP samples was purified and sequenced on Illumina Hiseq.
2015-11-02 | E-GEOD-73869 | biostudies-arrayexpress
Project description:Here we report that the histone variant macroH2A acts as a barrier to induced pluripotency. Using fibroblasts isolated from macroH2A double knockout mice, we observed enhanced reprogramming efficiency compared to fibroblasts from wild type animals. We further show that macroH2A isoforms act synergistically in this process. Genomic analysis in wild type fibroblasts reveals that macroH2A1 and H3K27me3 domains co-localize and occupy pluripotency genes. While the absence of macroH2A does not affect H3K27me3 in fibroblasts, macroH2A1 is highly enriched at a set of Utx target genes that are reactivated early during iPS reprogramming. Mononucleosomes from Dermal Fibroblasts (from wt and macroH2A1 and macroH2A2 double knockout mice) were isolated and ChIP'd with mH2A1, H3K27me3 and H3K27ac antibodies. DNA from Input and ChIP samples was purified and sequenced on Illumina's Hiseq.
2013-03-01 | E-GEOD-40813 | biostudies-arrayexpress
Project description:Glucocorticoids (GC) have been widely used as coadjuvants in the treatment of solid tumors, but GC treatment may be associated with poor pharmacotherapeutic response and/or prognosis. The genomic action of GC in these tumors is largely unknown. Here we find that dexamethasone (Dex, a synthetic GC) regulated genes in triple-negative breast cancer (TNBC) cells are associated with drug resistance. Importantly, these GC-regulated genes are aberrantly expressed in TNBC patients and associated with unfavorable clinical outcomes. Interestingly, in TNBC cells, Compound A (CpdA, a selective GR modulator) only regulates a small number of genes not involved in carcinogenesis and therapy resistance. Mechanistic studies using a ChIP-exo approach reveal that Dex- but not CpdA-liganded glucocorticoid receptor (GR) binds to a single glucocorticoid response element (GRE), which drives the expression of pro-tumorigenic genes. Our data suggest that development of safe coadjuvant therapy should consider the distinct genomic function between Dex- and CpdA-liganded GR. To study GR-regulated genes and define GRE in human genome, RNA-seq and GR ChIP-exo are performed in MDA-MB-231 cells before/after dex and CpdA stimulation. Each experiment includes two replicates.
2015-09-18 | E-GEOD-56022 | biostudies-arrayexpress
Project description:Here we report a novel role for H2A.Z.2 (H2AFV) as a mediator of cell proliferation and sensitivity to targeted therapies in malignant melanoma. While both H2A.Z.1 and H2A.Z.2 are highly expressed in metastatic melanoma and correlate with decreased patient survival, only H2A.Z.2 deficiency results in impaired cellular proliferation of melanoma cells, which occurs via a G1/S arrest. Integrated gene expression and ChIP-seq analyses revealed that H2A.Z.2 positively regulates E2F target genes, and that such genes acquire a distinct H2A.Z occupancy signature over the promoter and gene body in metastatic melanoma cells. We further identified the BET family member BRD2 as an H2A.Z-interacting protein in melanoma cells, and demonstrate that H2A.Z.2 silencing cooperates with BET inhibition to induce cell death. Mononucleosomes from SK-mel147 (wt and stably expressing eGFP-H2A. eGFP-H2A.Z.1 and eGFP-H2A.Z.2) and melanocytes were isolated for ChIP with H2A.Z antibody or GFP trap beads (Chromotek).
2015-07-01 | E-GEOD-68222 | biostudies-arrayexpress
Project description:The histone variant macroH2A generally associates with transcriptionally inert chromatin, however the factors that regulate its chromatin incorporation remain elusive. Here, we identify the SWI/SNF helicase, ATRX, as a novel macroH2A interacting protein. Unlike its role in assisting H3.3 chromatin deposition, ATRX acts as a negative regulator of macroH2A’s chromatin association. In human erythroleukemic cells deficient for ATRX, ChIP-sequencing studies reveal that macroH2A accumulates at the HBA gene cluster on the subtelomere of chromosome 16, coinciding with the loss of α globin expression. Collectively, our results implicate deregulation of macroH2A’s distribution as a contributing factor to the α thalassemia phenotype of ATRX syndrome. Mononucleosomes from K562 cells bearing integrated lentiviral shRNA constructs targeting either luciferase (shluc) or ATRX (sh92) were isolated and ChIP'd with mH2A1 antibody. DNA from shluc Input and the two mH2A1 ChIPs were isolated and sequenced on Illumina's Hiseq.
2012-03-08 | E-GEOD-35339 | biostudies-arrayexpress
Project description:Here we report a novel role for H2A.Z.2 (H2AFV) as a mediator of cell proliferation and sensitivity to targeted therapies in malignant melanoma. While both H2A.Z.1 and H2A.Z.2 are highly expressed in metastatic melanoma and correlate with decreased patient survival, only H2A.Z.2 deficiency results in impaired cellular proliferation of melanoma cells, which occurs via a G1/S arrest. Integrated gene expression and ChIP-seq analyses revealed that H2A.Z.2 positively regulates E2F target genes, and that such genes acquire a distinct H2A.Z occupancy signature over the promoter and gene body in metastatic melanoma cells. We further identified the BET family member BRD2 as an H2A.Z-interacting protein in melanoma cells, and demonstrate that H2A.Z.2 silencing cooperates with BET inhibition to induce cell death. Cross-linked ChIP in SKmel147 melamoma cell line for E2F1 and BRD2
2015-07-01 | E-GEOD-68223 | biostudies-arrayexpress
Project description:Here, we report that ATRX co-localizes with the H3K9-methyl transferase SETDB1 (also known as ESET), the co-repressor TRIM28 (also known as KAP1), and the transcription factor ZNF274 at 3â exons of Zinc Finger Genes (ZNFs) containing an atypical H3K9me3/H3K36me3 chromatin signature. Disruption of ATRX and ZNF274 leads to a significant reduction of H3K9me3, particularly at the 3â ZNF exons and other atypical chromatin regions, higher percentages of DNA damage, and defects in cell cycle. Taken together, our studies suggest that ATRX binds the 3â exons of ZNFs to maintain genomic stability through the regulation of their H3K9me3 levels XL-MNase ChIP-seq of ATRX was performed in the erythroleukemic cell line K562 and the Neuroblastoma cell line LAN6. Two independent replicates using different ATRX antibodies were performed in K562. Additionally, Native ChIP-seq of H3K9me3 in LAN6, ATRX WT and ATRX KO K562 cells was performed. Input samples were sequenced as control.
2016-04-05 | E-GEOD-70920 | biostudies-arrayexpress
Project description:Differential gene transcription enables development and homeostasis in all animals and is regulated by two major classes of distal cis-regulatory DNA elements (CREs), enhancers and silencers. While enhancers have been thoroughly characterized, the properties and mechansisms of silencers remain largely unknown. By an unbiased genome-wide functional screen in Drosophila melanogaster S2 cells, we discover a class of silencers that bind one of three transcription factors (TFs) and are generally not included in chromatin-defined CRE catalogs, as they mostly lack detectable DNA accessibility. The silencer-binding TF CG11247, which we term Saft, safeguards cell fate decisions in vivo and functions via a highly-conserved domain we term ZAC and the corepressor G9a, independently of G9a’s H3K9-methyltransferase activity. Overall, our identification of silencers with unexpected properties and mechanisms has important implications for the understanding and future study of repressive CREs, as well as the functional annotation of animal genomes.
2024-11-13 | PXD048161 | Pride
Project description:Background: Metastases to the brain from breast cancer have a high mortality. Basal-like and HER2 positive breast cancers appear to have a high propensity to spread to the brain. The mechanisms that allow cells to colonise the brain are unclear. Methods: We have analysed matched and unpaired samples of breast cancer and brain metastases using morphology, immunophenotype and expression profiling and validated the data using in vitro cell culturing models and in vivo mice model. Results: Most of the brain metastases were triple negative and had a basal-like phenotype. Metastatic cells to the brain over-expressed HER3 compared to primaries and showed evidence of higher activation of the MAPK pathways. Inhibition using anti-neuregulin antibody, Herceptin and Lapatinib reduced tumour growth in vitro and in vivo. Conclusions: The data demonstrate activation of neuregulin-HER3 pathway in brain metastases from breast cancer and suggest that even in absence of HER2 amplification (as with triple negative and basal cancers), anti-epidermal growth factor receptor family inhibitors may have a role in treating these patients An initial set of 29 matched pairs of primary breast cancer and their brain metastases and 22 unmatched brain metastases of from breast cancer was were available as formalin fixed-paraffin embedded (FFPE) tumor blocks. A second set of validation samples comprisinged of 10 matched pairs of primary breast cancer and their corresponding brain metastases and a further 11 non-breast metastatic brain cancers tumours fromn non-breast sites (one melanoma, six lung adenocarcinomas, one prostate carcinoma, one colon carcinoma and two renal cell carcinomas was also studied. After filtering DASL data on the first set of samples, 15/29 matched pairs and 22/22 unmatched metastases remained available for analysis for the initial set. In the second set all samples were analysed. RNA extraction and Real-Time RT-PCR Three 5μm thick FFPE sections of clinical samples, parental cell line MB-MDA-231 cell line (fixed in paraformoldehyde and embedded in paraffin) and intracranial mouse tumours were cut and de-waxed in two lots of xylene and two lots of 100% ethanol, 10 minutes each. RNA was extracted using the High Pure RNA Paraffin Kit® (Roche Applied Science, Mannheim, Germany) according to the manufacturerâs protocol. RNA was quantified using the NanoDrop® ND-1000 (NanoDrop Technologies, DE, USA). RT-PCR for HER3 and housekeeping genes GAPDH and RPL13a was carried out using the Rotor-gene system (Corbett Life Science, Australia). Complementary DNA (cDNA) was synthesized from 240ng of total RNA using oligodT16 primers and the SuperScriptTM III Reverse Transcriptase kit (Invitrogen, Carsbald, CA, USA). A standard curve for gene expression of HER3 and GAPDH and RPL13a was constructed using total RNA from a human breast cancer cell line (SKBR-3). Replicates of 10-fold dilutions of RNA in water were made to give 3 different calibrators, each with a known amount of SKBR-3 RNA for which arbitrary copy number were given. The PCR conditions were: 50°C for 2 minutes, 95°C for 2 minutes, followed by 40 cycles with the following profile: denaturation at 95°C for 20 seconds, annealing at 60°C for 15 seconds, extension at 72°C for 20 seconds. Flourescent incorporation was acquired in the green channel during the 72°C incubations. Intron spanning primer sequences were: GAPDH (5âCTGCACCACCAACTGCTTAG3â, 5âGTCTTCTGGGTGGCA GTGAT3â), RPL13a (5âGTTGGTGTTCATCCGTTG3â, 5âGTACGCTGTGAAGCATCAA3â), HER3 (5âTGGTTCATGGGCATGTATCC3â, 5âCTAGACCTAAGACTTGGAGC3â). DASL gene expression profilingGene expression profiling was performed using the DASL assay (cDNA-mediated annealing, selection extension and ligation, Illumina Inc., California, USA) interrogating the DASL Cancer Panel that contained 512 cancer related genes. The first and second sets of samples were analyzed in two independent experiments. Tumours arising from the animal experiment were analyzed in conjunction with the second set of clinical samples. All protocols were as specified by Illumina Inc. Briefly, RNA (250ng) was converted to cDNA through a reverse transcription reaction with biotinylated oligo-d(T)18 and random nonamers. Oligonucleotides (three unique pairs for each of the 512 genes) were annealed to the biotinylated cDNA, the duplexes were bound to streptavidin conjugated paramagnetic particles to remove non-hybridized oligos. The annealed oligos were then extended and ligated (to incorporate an address sequence and primer site) to generate amplifiable products. These products were subjected to PCR amplification using fluorescently labeled (Cy3 and Cy5) primers. The labeled PCR products were hybridized to a Sentrix array or Beadchip. Following hybridization, the arrays were scanned with a BeadArray Reader (Illumina) and data was extracted using BeadStudio software (Illumina). Samples exhibiting a median hybridization intensity across all probes of <600 (background corrected) were excluded from analysis. Probes with a BeadStudio detection score greater than 0.99 in more than 15 conditions were included. Array data transformation and normalization (per chip normalized to 50th percentile and per gene normalized to median) was done in Genespring® version 7.0 software (Agilent Technologies, Santa Clara, USA). Hierarchical clustering was performed using: Similarity measure; Pearson Correlation and clustering algorithm; Average Linkage. Genes differentially expressed between primary tumors and brain metastases were identified using analysis of variance (ANOVA, p<0.01) or parametric test, variances not assumed equal (Welch t-test, p < 0.005). Up and down regulation was considered for normalized data values that were greater or less than a factor of 2 fold for the conditions compared.
2010-06-24 | E-GEOD-14682 | biostudies-arrayexpress
Project description:This SuperSeries is composed of the following subset Series: GSE14682: Metastatic breast cancer to the brain: set 1 GSE14683: Metastatic breast cancer to the brain: set 2 Refer to individual Series
2010-06-24 | E-GEOD-14690 | biostudies-arrayexpress