Browse
Submit Data
Databases
API
Help

Metabolomics,Unknown,Transcriptomics,Genomics,Proteomics

Dataset Information

48 Views

0 Connections

0 Citations

0 Reanalyses

0 Downloads

Omics score: 0

MicroRNA expression profile of medullary thymic epithelial cells - mTEC 3.10 strain - submitted of in vitro Aire knockdown - siRNA silencing-

ABSTRACT: The oligo microarrays were used to determine microRNA expression profiles of medullary thymic epithelial cells (mTECs) submitted of in vitro Aire Knockdown (siRNA silencing).

ORGANISM(S): Mus musculus

SUBMITTER: Geraldo Passos

PROVIDER: E-MEXP-3359 | biostudies-arrayexpress |

REPOSITORIES: biostudies-arrayexpress

ACCESS DATA

Json Xml

Publications

Autoimmune regulator (Aire) controls the expression of microRNAs in medullary thymic epithelial cells.

Macedo Claudia C Evangelista Adriane F AF Marques Márcia M MM Octacílio-Silva Shirlei S Donadi Eduardo A EA Sakamoto-Hojo Elza T ET Passos Geraldo A GA

Immunobiology 20120702 4

The autoimmune regulator (Aire) is a transcription factor that controls the ectopic expression of a large set of peripheral tissue antigen (PTA) genes in medullary thymic epithelial cells (mTECs). Recent evidence has demonstrated that Aire releases stalled RNA polymerase II (RNA Pol II) from blockage at the promoter region of its target genes. Given that, in addition to messenger RNAs (mRNA), RNA Pol II also transcribes microRNAs (miRNAs), we raised the hypothesis that Aire might play a role as ...[more]

PMID: 22883565

Similar Datasets

siRNAi profiling of mouse thymus treated with GIM anti-AIRE

Project description:We used the TriFecta TM (IDT, Integrated DNA Technologies, USA) anti-Aire siRNA sequence (GGAUUCUCUUUAAGGACUACAAUCTAGAUUGUAGUCCUUAAAGAGAAUCCUC) to silencing Aire mRNA. Confluent cultures of 3.10 mTEC cell line were transfected with 10 nM of anti-Aire siRNA using Hiperfect reagent (Qiagen) following manufacturers instructions. After transfection, cells were cultured during 24 h in RPMI medium as above mentioned and total RNA was extracted using the mirVana kit (Ambion), which served as template for cDNA synthesis. Gene knockdown was confirmed by semi-quantitative reverse transcription PCR (RT-PCR) using the primers 5prim CATCCTGGATTTCTGGAGGA 3prim forward and 5prim GCTCTTTGAGGCCAGAGTTG 3prim reverse, which allowed amplification of a 253 bp PCR product corresponding to a segment of the Aire mRNA (cDNA). The PCR mix contained 200 uM dNTPs, 1.5 mM MgCl2, 50 mM KCl, 10 mM TRIS-HCl (pH 8.4), 10 uM each primer and 2 U Taq DNA polymerase. The cycling temperature was: 35 x 30 sec each (94oC, 57oC and 72oC). An anti-HPRT siRNA included in this kit but whose sequence was not furnished was used in parallel to evaluate the efficiency of the gene knockdown assay on 3.10 mTEC cell line (data not shown).

2009-08-30 | E-MEXP-2181 | biostudies-arrayexpress

Transcription profiling of mouse thymus gland from pre-diabetic and diabetic animals.

Project description:Female NOD mice were born in specific pathogen free (SPF) conditions at the CEMIB-UNICAMP animal facility (University of Campinas, Sï¿½o Paulo, Brazil) and maintained in SPF mini-isolators in our laboratory at the University of Sï¿½o Paulo, Campus of Ribeirï¿½o Preto, Brazil. We studied both pre-diabetic (8ï¿½2 week-old) and diabetic (20ï¿½2 week-old) animals. Diabetes was confirmed by blood glucose levels (?250 mg glucose/dL) using the Accu Check ï¿½ Active Kit (Roche Diagnï¿½stica Brasil, Sï¿½o Paulo, Brazil). The thymic stroma was separated from the whole thymus. The mTEC 3.10 medullary thymic epithelial cell line was established from C57BL/6 mice, and the original medullary phenotype was confirmed by immunostaining with anti-cytokeratin monoclonal antibodies. In addition, the CD80+ phenotype was confirmed using fluorescent activated cell sorting (FACS) analysis. Cells were cultured in 10% fetal bovine serum-supplemented RPMI 1640 medium at 37oC and 5% CO2. Total RNA was extracted from 1x107 stromal cells (from pre-diabetic and diabetic animals) and 1x107 mTEC 3.10 cells using Trizolï¿½ Reagent and following the manufacturerï¿½s instructions (Invitrogen, Carlsbad, CA, USA). RNA preparations were confirmed to be free of proteins and phenol using UV spectrophotometry and the state of degradation was assessed using agarose gel electrophoresis (ethidium bromide staining).

2009-11-16 | E-MEXP-2339 | biostudies-arrayexpress

Transcription profiling of mouse thymus glandwfrom normal and ollagen induced arthritis animals

Project description:DBA/1J and DBA-2/J mice (12-14 weeks old) weighing 18ï¿½22 g were housed in temperature-controlled rooms (22ï¿½25ï¿½C) in the animal facility of the School of Medicine of Ribeirï¿½o Preto, University of Sï¿½o Paulo, Sï¿½o Paulo, Brazil, and received water and food ad libitum. DBA/1J and DBA-2/J male mice were used in type II collagen immunizations. For CIA, at day zero, DBA/1J males were intradermally injected at the base of the tail with 200 ï¿½g of bovine type II collagen (CII) (Sigma) in 100ï¿½l of 0.05 M acetic acid emulsified with equal volume of complete Freundï¿½s adjuvant (Chondrex, Redmond, WA). On day 21, a second injection of CII (200 ï¿½g in acetic acid) was given intraperitoneally (i.p). DBA/2J males were also immunized with CII and served as controls. A caliper was used to determine the paw diameter and swelling was determined as the increase in diameter compared to day zero of immunization. The thymic stroma was separated from the whole thymus. The mTEC 3.10 medullary thymic epithelial cell line was established from C57BL/6 mice, and the original medullary phenotype was confirmed by immunostaining with anti-cytokeratin monoclonal antibodies. In addition, the CD80+ phenotype was confirmed using fluorescent activated cell sorting (FACS) analysis. Cells were cultured in 10% fetal bovine serum-supplemented RPMI 1640 medium at 37oC and 5% CO2. Total RNA was extracted from 1x107 stromal cells and from 1x107 mTEC 3.10 cells using Trizolï¿½ Reagent and following the manufacturerï¿½s instructions (Invitrogen, Carlsbad, CA, USA). RNA preparations were confirmed to be free of proteins and phenol using UV spectrophotometry and the state of degradation was assessed using agarose gel electrophoresis (ethidium bromide staining).

2009-10-01 | E-MEXP-2338 | biostudies-arrayexpress

GIM mTEC Aire silencing

Project description:We used the TriFectaTM (IDT, Integrated DNA Technologies, Coralville, IA, USA) anti-Aire RNAi sequence (GGAUUCUCUUUAAGGACUACAAUCTAGAUUGUAGUCCUUAAAGAGAAUCCUC) in order to silencing Aire mRNA. Confluent cultures of 3.10 mTEC cell line were transfected with 10nM of anti-Aire siRNA using Hiperfect reagent (Qiagen, GmbH, Hilden, Germany) following manufacturerM-^Rs instructions. After transfection, cells were cultured during 24 h in RPMI medium as above mentioned and total RNA was extracted using the mirVana kitM-. (Ambion, Austin, TX, USA), which served as template for cDNA synthesis. Gene knockdown was confirmed by quantitative reverse transcription PCR (qRT-PCR) using the primers 5_-GCAACTCTGGCCTCAAAGAG-3_ forward and 5_-GGTCTGAATTCCGTTTCCAA-3_ reverse, which allowed amplification of a 120 bp PCR product corresponding to a segment of the Aire cDNA. The cDNA samples were prepared using Superscript II reverse transcriptase (Invitrogen Corporation, Carlsbad, CA, USA) enzyme, as recommended. Expression of the above mentioned genes was quantified using a 7500 Real Time PCR System (Applied Biosystems)

2011-08-31 | E-MEXP-3213 | biostudies-arrayexpress

Transcription profiling of mouse thymus in pre diabetic and diabetic state of NOD (non obese diabetic) animal strain

Project description:The current project is within the range of molecular immunogenetic auto immune diseases and refers to the comparative study of promiscuous gene expression of tissue-specific antigens (TSAs) in the thymus of NOD mice line (non obese diabetic) who plays the auto-immune diabetes mellitus type 1, during the transition from state pre-diabetics to diabetics. Use the technology of oligo arrays to investigate the expression of miRNAs and cDNA microarrays to investigate the expression of genes encoding the messenger RNAs including TSAs (tissue specific antigens). Use the technology of oligo arrays to investigate the expression of miRNAs and cDNA microarrays to investigate the expression of genes encoding the messenger RNAs including TSAs (tissue specific antigens). Female NOD mice were born in specific pathogen free (SPF) conditions at the CEMIB-UNICAMP animal facility (University of Campinas, SP, Brazil) and maintained in SPF mini-isolators in our laboratory at the University of Sï¿½o Paulo, Campus of Ribeirï¿½o Preto, Brazil. We studied both pre-diabetic (8ï¿½2 week-old) and diabetic (20ï¿½2 week-old) animals. Diabetes was confirmed by blood glucose levels (?250 mg glucose/dL) using the Accu Check ï¿½ Active Kit (Roche Diagnï¿½stica Brasil, Sï¿½o Paulo, Brazil). The thymic stroma was separated from the whole thymus, as previously described (Gray et al. 2002). The central idea is to trace signatures of differential gene expression of the thymus at different stages (transition from state pre-diabetics to diabetics) and, using bioinformatics programs, applied to the analysis of data from arrays [Cluster & Tree View (for signatures of expression), SAM (for statistical analysis of the miRNAs and differentially expressed genes from TSAs), GenMiR++ and Cytoscape (to establish networks between miRNAs genes and genes of TSAs)].

2009-10-14 | E-MEXP-2321 | biostudies-arrayexpress

Transcription profiling of lymph node from mice with collagen induced arthritis in response to the endothelin receptor antagonist Bosentan

Project description:DBA/1J mice (12 wk old; weighing 18-22 g) were housed in temperature-controlled rooms (22-25 C) in the animal facility of the School of Medicine of Ribeir o Preto, University of Sao Paulo, Sao Paulo, Brazil, and received water and food ad libitum. Male DBA/1J mice received 200 g of bovine type II collagen (CII) in CFA by intradermal injection (day 0). Collagen (200 ?g in PBS) was given again on day 21 by i.p. injection. Mice were monitored daily for signs of arthritis for which severity scores were derived as follows: 0=normal, 1=erythema, 2=erythema plus swelling, 3= extension/loss function and total score = sum of four limbs. Disease onset characterized by erythema and/or paw swelling was seen between days 25 and 35. For the therapeutic approach, DBA/1 mice were treated with Bosentan (100 mg kg-1) p.o. or vehicle once a day for a total of 11 days. The treatment began on day that CIA became clinically detectable. The DBA-1/J mice were sacrificed preferentially by CO2 inhalation, and the lymph nodes removed. To obtain sufficient mRNA for hybridization to the glass slides, total inguinal lymph nodes RNA was pooled from three mice at each time point (2 inguinal lymph nodes per mouse). Total RNA samples were prepared using Trizol® reagent according to the manufacturers instructions. Undegraded and DNA-, protein- and phenol-free RNA preparations were verified by classic agarose gel electrophoresis stained with ethidium bromide and ultraviolet spectrophotometry, respectively.

2009-10-20 | E-MEXP-2404 | biostudies-arrayexpress

miRNA post transcriptional control of umbilical cord mesenchymal stem cell osteogenic differentiation.

Project description:Umbilical cord mesenchymal stem cells were stimulated to osteogenesis by 24h, 48h and 7 days. Undifferentiated and treated cells have their total RNA extracted and 25 ug were used to extract micro RNAs by Flash PAGE Fractionator (Ambion). These miRNA were labeled and used to hybridize to 662 oligo arrays corresponding to miRNA sequences from human, rat and mouse. The hybridized slides were scanned in the Amersham Automatic Slide Processor, quantified by TIGR Spotfinder software and submitted to stathiscal treatment in TIGR MEV software.

2011-07-31 | E-MEXP-3080 | biostudies-arrayexpress

Transcriptional profile in TECs

Project description:Cortical 1.4C18 and medullary 3.10 TEC lines (mTEC) were cultured in 10% fetal bovine serum-supplemented RPMI 1640 medium at 37 ?C in a 5% CO2 atmosphere. Confluent cultures of 3.10 mTEC cell line were cultured during 72 h in RPMI medium as above mentioned and total RNA was extracted using the mirVana kitM-. (Ambion, Austin, TX, USA).

2011-08-31 | E-MEXP-3214 | biostudies-arrayexpress

MicroRNA profiling of mouse thymus from diabetic and pre-diabetic NOD (non obese diabetic) animals

2009-10-10 | E-MEXP-2245 | biostudies-arrayexpress

MicroRNA profiling of human umbilical cord mesenchymal stem cells during osteogenic differentiation

Project description:The time course experiment was designed as follow: (1) Mesenchymal stem cell (indifferentiated cells)/ time 0h; (2) After 24 h of osteogenic induction; (3) After 48 h of osteogenic induction (4) After 7 days of osteogenic induction.

2009-10-10 | E-MEXP-2259 | biostudies-arrayexpress

OmicsDI is part of the ELIXIR infrastructure

OmicsDI is an Elixir interoperability service. Learn more ›

Tweets

OmicsDI Databases

PRIDE
PeptideAtlas
MassIVE
JPOST Repository
Physiome Model Repository

EGA
EVA
ENA
LINCS
PAXDB
Cell Collective

MetaboLights
Metabolomics Workbench
MetabolomeExpress
GNPS
BioModels
FAIRDOMHub

ArrayExpress
dbGaP
ExpressionAtlas
GEO
NODE

Information

Databases
Help
API
Contact us
Code on GitHub
Terms of use
Submit Data