Browse
Submit Data
Databases
API
Help

Metabolomics,Unknown,Transcriptomics,Genomics,Proteomics

Dataset Information

0 Views

0 Connections

0 Citations

0 Reanalyses

0 Downloads

Omics score: 0

GIM mTEC Aire silencing

ABSTRACT: We used the TriFectaTM (IDT, Integrated DNA Technologies, Coralville, IA, USA) anti-Aire RNAi sequence (GGAUUCUCUUUAAGGACUACAAUCTAGAUUGUAGUCCUUAAAGAGAAUCCUC) in order to silencing Aire mRNA. Confluent cultures of 3.10 mTEC cell line were transfected with 10nM of anti-Aire siRNA using Hiperfect reagent (Qiagen, GmbH, Hilden, Germany) following manufacturerM-^Rs instructions. After transfection, cells were cultured during 24 h in RPMI medium as above mentioned and total RNA was extracted using the mirVana kitM-. (Ambion, Austin, TX, USA), which served as template for cDNA synthesis.

Gene knockdown was confirmed by quantitative reverse transcription PCR (qRT-PCR) using the primers 5_-GCAACTCTGGCCTCAAAGAG-3_ forward and 5_-GGTCTGAATTCCGTTTCCAA-3_ reverse, which allowed amplification

of a 120 bp PCR product corresponding to a segment of the Aire cDNA. The cDNA samples were prepared using Superscript II

reverse transcriptase (Invitrogen Corporation, Carlsbad, CA, USA) enzyme, as recommended. Expression of the above mentioned genes was quantified using a 7500 Real Time PCR System (Applied Biosystems)

ORGANISM(S): Mus musculus

SUBMITTER: Geraldo Passos

PROVIDER: E-MEXP-3213 | biostudies-arrayexpress |

REPOSITORIES: biostudies-arrayexpress

ACCESS DATA

Json Xml

Similar Datasets

siRNAi profiling of mouse thymus treated with GIM anti-AIRE

Project description:We used the TriFecta TM (IDT, Integrated DNA Technologies, USA) anti-Aire siRNA sequence (GGAUUCUCUUUAAGGACUACAAUCTAGAUUGUAGUCCUUAAAGAGAAUCCUC) to silencing Aire mRNA. Confluent cultures of 3.10 mTEC cell line were transfected with 10 nM of anti-Aire siRNA using Hiperfect reagent (Qiagen) following manufacturers instructions. After transfection, cells were cultured during 24 h in RPMI medium as above mentioned and total RNA was extracted using the mirVana kit (Ambion), which served as template for cDNA synthesis. Gene knockdown was confirmed by semi-quantitative reverse transcription PCR (RT-PCR) using the primers 5prim CATCCTGGATTTCTGGAGGA 3prim forward and 5prim GCTCTTTGAGGCCAGAGTTG 3prim reverse, which allowed amplification of a 253 bp PCR product corresponding to a segment of the Aire mRNA (cDNA). The PCR mix contained 200 uM dNTPs, 1.5 mM MgCl2, 50 mM KCl, 10 mM TRIS-HCl (pH 8.4), 10 uM each primer and 2 U Taq DNA polymerase. The cycling temperature was: 35 x 30 sec each (94oC, 57oC and 72oC). An anti-HPRT siRNA included in this kit but whose sequence was not furnished was used in parallel to evaluate the efficiency of the gene knockdown assay on 3.10 mTEC cell line (data not shown).

2009-08-30 | E-MEXP-2181 | biostudies-arrayexpress

GIM musmusculus anti-Dicer RNAi silencing

Project description:We used the TriFectaTM (IDT, Integrated DNA Technologies, Coralville, IA, USA) anti-Dicer RNAi sequence (AGAACGAAAUGCAAGGAAUGGACTCGAGUCCAUUCCUUGCAUUUCGUUCUUC, ACAAGAAACGGAAUCACAUCACACTAGUGUGAUGUGAUUCCGUUUCUUGUCG, GCAGUUGUCCUAAACAGAUUGAUAAUUAUCAAUCUGUUUAGGACAACUGCUG) to silencing Dicer mRNA. Confluent cultures of 3.10 mTEC cell line were transfected with 20 nM of each anti-Dicer siRNA using Hiperfect reagent (Qiagen) following manufacturerM-^Rs instructions. After transfection, cells were cultured during 24 h in RPMI medium as above mentioned and total RNA was extracted using the mirVana kit (Ambion), which served as template for cDNA synthesis. Gene knockdown was confirmed by quantitative PCR (qRT-PCR) using the primers 5M-^RCCCAAATGTAGAACCCGAGA 3M-^R forward and 5M-^RCAACCGACACTGTCCATCG 3M-^R reverse, which allowed amplification of a 119 bp PCR product corresponding to a segment of the Dicer mRNA (cDNA). Transcriptional expression levels were determined using a StepOne Real-Time PCR System (Applied Biosystems, USA).

2011-08-30 | E-MEXP-3211 | biostudies-arrayexpress

microRNA expression profile of medullary thymic epithelial cells - mTEC 3.10 strain - submitted of in vitro Aire knockdown - siRNA silencing-

Project description:The oligo microarrays were used to determine microRNA expression profiles of medullary thymic epithelial cells (mTECs) submitted of in vitro Aire Knockdown (siRNA silencing).

2012-08-21 | E-MEXP-3359 | biostudies-arrayexpress

Transcriptional profile in TECs

Project description:Cortical 1.4C18 and medullary 3.10 TEC lines (mTEC) were cultured in 10% fetal bovine serum-supplemented RPMI 1640 medium at 37 ?C in a 5% CO2 atmosphere. Confluent cultures of 3.10 mTEC cell line were cultured during 72 h in RPMI medium as above mentioned and total RNA was extracted using the mirVana kitM-. (Ambion, Austin, TX, USA).

2011-08-31 | E-MEXP-3214 | biostudies-arrayexpress

The effect of the Autoimmune regulator (Aire) gene on mRNA and lncRNA transcriptional profile of mTEC 3.10 cell line

Project description:In this study, we used the murine (Mus musculus) medullary thymic epithelial cell line (mTEC 3.10 cell line) co-cultured with fresh thymocytes as a functional assay for mTEC-thymocyte adhesion. Then we analyzed the differential transcriptional profile of this cell line, by means of Agilent oligo microarray hybridization, comparing Autoimmune regulator (Aire) wild-type cells vs Crispr-Cas9-induced Aire KO cells. The comparative transcriptional expression signatures allowed us to find those differentially expressed mRNAs or lncRNAs between the samples tested.

2021-12-31 | E-MTAB-6541 | biostudies-arrayexpress

The effect of the Autoimmune regulator (Aire) gene on microRNA transcriptional profile of 3.10 mTEC cell line

Project description:Medullary thymic epithelial cells (mTECs) contribute to self-tolerance through the ectopic expression of peripheral tissue antigens (PTAs) in the thymus. Autoimmune regulator (Aire) is to date the best characterized transcriptional regulator known to at least partially coordinate PTA expression in mTECs. Furthermore the expression of Aire-dependent and -independent genes is also modulated by microRNAs. Given the transcriptional regulation exerted by Aire in mTEC cells and the role of miRNAs in post-transcriptional control, we used a Mus musculus mTEC cell line (3.10) which constitutively express Aire in culture) to knockdown Aire gene by means of siRNA transfection and then observe the effect of Aire knockdown in the transcriptional profile of miRNAs by means of oligomicroarrays. The Agilent oligomicroarrays were used to determine the large scale the miRNA transcriptional profiles of control or Aire-knockdown 3.10 mTECs.

2016-06-27 | E-MTAB-4596 | biostudies-arrayexpress

The role of Autoimmune regulator (Aire) gene in the control of adhesion between medullary thymic epithelial cells and thymocytes

Project description:The crosstalk between thymocytes and thymic epithelial cells is critical for T cell development and establishment of central tolerance. Although the role of Autoimmune Regulator (Aire) gene in the induction of central tolerance is well known, the precise cellular and molecular mechanisms by which Aire controls the ectopic expression of tissue restricted antigens (TRAs) in medullary thymic epithelial cells (mTECS) remain unclear. In this study we performed a functional assay with fresh thymocytes dissociated from a normal mouse thymus co-cultured with a Mus musculus mTEC cell line - named 3.10 mTEC line - , in which we had previously knocked-down Aire gene by means of siRNA transfection. Agilent Mouse Gene Expression microarrays were used to determine the large scale transcriptional expression profiles of control and Aire-knockdown 3.10 mTECs co-cultured with thymocytes.

2016-06-27 | E-MTAB-4595 | biostudies-arrayexpress

The effect of the autoimmune regulator (Aire) gene on the transcriptional expression profile of 3.10 mTEC cell line.

Project description:Medullary thymic epithelial cells (mTECs) contribute to self-tolerance through the ectopic expression of peripheral tissue antigens (PTAs) in the thymus. PTA expression in mTECs is largely dependent on the autoimmune regulator (Aire) gene. Here we used a Mus musculus mTEC cell line (3.10 mTEC line, which constitutively express Aire in culture) to knockdown Aire gene by means of siRNA transfection. Aire knockdown was confirmed by means of qRT-PCR and RNA-FISH (for Aire mRNA levels), immunofluorescence and western blot (for AIRE protein levels).The Agilent oligo microarrays were used to determine the large scale transcriptional expression profiles of control or Aire-knockdown 3.10 mTECs.

2015-12-31 | E-MTAB-3879 | biostudies-arrayexpress

Post-transcriptional control of Aire gene by the microRNA 155

Project description:In this study, we transfected murine (Mus musculus) medullary thymic epithelial cell line (mTEC 3.10 cell line) with miR155 mimic to assess a possible post-transcriptional control of the miRNA over the Aire gene. Then we analyzed the differential transcriptional profile of this cell line, by means of Agilent oligo microarray hybridization, comparing Autoimmune regulator (Aire) wild-type cells vs cells transfected with miR155 mimic. The comparative transcriptional expression signatures allowed us to find those differentially expressed mRNAs between the samples tested.

2022-10-01 | E-MTAB-7709 | biostudies-arrayexpress

Project title: Endogenous AIRE-immunoprecipitation from primary human neutrophils

Project description:Autoimmune regulator (AIRE) is a transcriptional regulator. We here assess the role for AIRE in primary human neutrophils. We found that the functional role for AIRE in neutrophils is to regulate the extrinsic apoptotic pathway involving the Fas/TNFR death receptors and Cathepsin G and the expression of unique immune mediators.

2024-01-25 | PXD047989 | Pride

OmicsDI is part of the ELIXIR infrastructure

OmicsDI is an Elixir interoperability service. Learn more ›

Tweets

OmicsDI Databases

PRIDE
PeptideAtlas
MassIVE
JPOST Repository
Physiome Model Repository

EGA
EVA
ENA
LINCS
PAXDB
Cell Collective

MetaboLights
Metabolomics Workbench
MetabolomeExpress
GNPS
BioModels
FAIRDOMHub

ArrayExpress
dbGaP
ExpressionAtlas
GEO
NODE

Information

Databases
Help
API
Contact us
Code on GitHub
Terms of use
Submit Data