Transcription profiling by array of female Anopheles gambiae following control-PBS or sHz inoculation in order to determine which genes and pathways were activated
Ontology highlight
ABSTRACT:
ORGANISM(S): Anopheles gambiae
SUBMITTER: Maria Simoes
PROVIDER: E-MTAB-1072 | biostudies-arrayexpress |
REPOSITORIES: biostudies-arrayexpress
Similar Datasets
Project description:In the present study, we have investigated the effect of CpG Oligodeoxynucleotides (CpG-ODN) on the outcome of Plasmodium infection of the mosquito vectors Anopheles stephensi and Anopheles gambiae and on the modulation of mosquito immunity to Plasmodium. Anopheles mosquitoes inoculated with CpG-ODN showed significant reduction of Plasmodium infection rate and intensity. Microarrays were used to profile transcription of fat-body from CpG-ODN-treated mosquitoes. Mosquitoes were dissected 18h after ODN inoculation (immediately before feeding). Batches of 20 to 30 fat bodies (abdomen without midgut, ovaries and malpighian tubule]) were dissected in cold DEPC-treated phosphate-buffered saline (PBS) and processed for RNA preparation. Mosquitoes treated with CpG-ODNs are less susceptible to Plasmodium infection. Transcription profile of fat body indicates that protection was associated with coagulation/wound healing, while melanization appears to be depressed. Anopheles gambiae s.s. mosquitoes were reared at 25 M-BM-:C and 75% humidity with a 12-hour light/dark cycle. Adult mosquitoes were maintained on a 10% glucose solution. Three- to four-day-old female mosquitoes were cold-anaesthetized and inoculated intratoraxically with 69nl of a 0.1mM CpG-oligodeoxynucleotide (0604 -5M-bM-^@M-^Y TCCATGACGTTCCTGATGCT 3M-bM-^@M-^Y) solution or with the same volume of elution buffer using a Nanoject micro-injector (Drummond Scientific). Mosquitoes were left to rest for 18h. Batches of 20 to 30 fat bodies (abdomen without midgut, ovaries and malpighian tubule) were dissected in cold DEPC-treated phosphate-buffered saline (PBS) and processed for RNA preparation. Two independent experiments were performed for each treatment.
2013-04-02 | E-GEOD-26941 | biostudies-arrayexpress
Project description:Mosquitoes possess an innate immune system that is capable of limiting infection by a variety of pathogens, including the Plasmodium spp. parasites responsible for human malaria. The Anopheles immune deficiency (IMD) innate immune signaling pathway confers resistance to Plasmodium falciparum. While some previously identified Anopheles anti-Plasmodium effectors are regulated through signaling by Rel2, the transcription factor of the IMD pathway, many components of this defense system remain uncharacterized. To begin to better understand the regulation of immune effector proteins by the IMD pathway, we used oligonucleotide microarrays and iTRAQ to analyze differences in mRNA and protein expression, respectively, between transgenic An. stephensi mosquitoes exhibiting blood meal-inducible overexpression of an active recombinant Rel2 and their wild-type conspecifics. Numerous genes were differentially regulated at both the mRNA and protein levels following induction of Rel2. While multiple immune genes were up-regulated, a majority of the differentially expressed genes have no known immune function in mosquitoes. Identified sequences were assigned putative functions and gene ontology (GO) terms based on homology to previously annotated A. gambiae gene sequences. Selected up-regulated genes from multiple GO categories were tested for both anti-Plasmodium and anti-bacterial action using RNA interference (RNAi). Based on our experimental findings, we conclude that increased expression of the IMD immune pathway-controlled transcription factor Rel2 affects the expression of numerous genes with diverse functions, suggesting a broader physiological impact of immune activation and possible functional versatility of Rel2. Our study has identified multiple novel anti-Plasmodium effectors. Midguts from midgut-specific transgenic A. stephensi at 6 and 12 hours post-blood meal and fat bodies from fat body-specific transgenic A. stephensi at 12 and 18 hours post-blood meal were compared to wild-type A. stephensi at the same time points. 3 biological replicates and 1 pseudo-replicate per array.
2014-07-11 | E-GEOD-59258 | biostudies-arrayexpress
Project description:Fat body is an important tissue in the context of vitellogenesis, vector immunity, vector physiology and vector-parasite interaction. However, the proteome of fatbody and impact of blood meal on the gene expression of this vital organ has not been investigated so far. Therefore, in this study, we made an attempt to identify proteins expressed in fatbody of An. stephensi and their altered expression in response to blood meal. In all, we identified 4,504 proteins in the fatbody using multiple fractionation strategies, which is by far the largest resource of fatbody proteome in any mosquito species. Further, comparative proteomic analysis of fatbody 24 and 48 hours post blood meal led to identification of over 300 differentially expressed proteins. Bioinformatics analysis of these proteins suggested their role in vitellogenesis, lipid transport, mosquito immunity and oxidation-reduction processes. Interestingly, we identified four novel genes,which were found to be differentially expressed upon blood meal. These proteins are potential target for vector control strategies and development of transmission blocking vaccines.
2018-01-03 | PXD006462 | Pride
Project description:Here, we examined the transcriptional and epigenetic (DNA methylation) responses to viral infection in honey bee workers. One-day old worker honey bees were fed solutions containing Israeli Acute Paralysis Virus (IAPV), a virus which causes muscle paralysis and death and has previously been associated with colony loss. Uninfected control and infected, symptomatic bees were collected within 20-24 hours after infection. Worker fat bodies, the primary tissue involved in metabolism, detoxification and immune responses, were collected for analysis. We performed transcriptome- and bisulfite-sequencing of the worker fat bodies to identify genome-wide gene expression and DNA methylation patterns associated with viral infection. There were 753 differentially expressed genes (FDR<0.05) in infected versus control bees, including several genes involved in epigenetic and antiviral pathways. DNA methylation status of 156 genes (FDR<0.1) changed significantly as a result of the infection, including those involved in antiviral responses in humans. There was no significant overlap between the significantly differentially expressed and significantly differentially methylated genes, and indeed, the genomic characteristics of these sets of genes were quite distinct. Our results indicate that honey bees have two distinct molecular pathways, mediated by transcription and methylation, that modulate protein levels and/or function in response to viral infections. Examination of epigenomic and transcriptomic antiviral responses to Israeli Acute Paralysis Virus in honey bees
2015-02-06 | E-GEOD-65659 | biostudies-arrayexpress
Project description:Compare miRNA expression profiles in epididymal adipocytes from normal and leptin deficient obese mice
2009-02-21 | E-MEXP-1789 | biostudies-arrayexpress
Project description:Aging animals display a decline in a multitude of physical and physiological functions, including muscle function and strength. Muscle gene expression in dogs has been evaluated for a few select genes under pathogenic or varying dietary conditions, but global gene expression profiles of aged animals has not been performed. Because the mechanisms contributing to age-related decline in muscle function are poorly defined, we used canine microarrays to compare gene expression profiles of muscle tissue from geriatric and young adult dogs. Skeletal muscle (biceps femoris) samples were collected from 6 geriatric (12 yr-old) and 6 young adult (1 yr-old) female beagles after being fed one of two diets (animal protein-based versus plant-protein based) for 12 months. RNA samples were hybridized to Affymetrix GeneChip Canine Genome Arrays. Statistical analyses indicated that age had the greatest impact on gene expression, with 262 genes differentially expressed in geriatric dogs. Although not as robust as age, diet affected mRNA abundance of 22 genes. The effect of age was most notable in genes related to metabolism, cell cycle and cell development, and transcription function, with all of these functional groups being predominantly down-regulated in older animals. The effect of diet on gene expression was mostly limited to the geriatric animals, but interactions between age and diet do not allow for a clear-cut pattern of gene expression to be observed. Keywords: age; diet Six geriatric (11.1 yr old) and 6 weanling (8 wk old) female beagles were used. Three dogs of each age were assigned to one of two dietary treatments and fed for 12 months. Diets tested in this experiment were previously shown to manipulate energy metabolism. One diet was an animal-protein based diet (APB) and was composed primarily of highly digestible ingredients and animal-derived protein and fat sources (brewerâs rice, poultry by-product meal, poultry fat) and was formulated to contain 28% protein, 23% fat, and 5% dietary fiber. The other diet was a plant-protein based diet (PPB) and was composed primarily of moderately digestible plant-derived ingredients (corn, soybean meal, wheat middlings, and meat and bone meal) and was formulated to contain 26% protein, 11% fat, and 15% dietary fiber. Although the two diets were very different in terms of ingredient and chemical composition, both were formulated to meet or exceed all nutrient requirements for canine growth according to the Association of American Feed Control Officials. Young dogs were fed ad libitum to allow for adequate growth, while geriatric dogs were fed to maintain baseline BW throughout the experiment. To produce the desired metabolic effects, the PPB diet was formulated to contain a lower caloric density (APB = 5.38 kcal/g; PPB = 4.75 kcal/g) and have a lower nutrient digestibility than the APB diet. Thus, dogs fed the PPB diet needed to consume a greater (P<0.05) quantity of food (237 g/d; 1123 kcal/d) than dogs fed the APB diet (166 g/d; 893 kcal/d) to grow (young) or maintain BW (geriatrics). Even though metabolic indices were altered, mean BW among dietary treatments was not different at any time over the course of the study for young or geriatric dogs. After 12 months on experiment, animals were fasted for 12 hr and then given a lethal dose (130 mg/kg BW) of sodium pentobarbital (Euthasol, Virbac Corp., Fort Worth, TX) intravenously into the left forearm. Death was confirmed by lack of respiration and a corneal reflex, and absence of a heartbeat detected with a stethoscope placed under the left elbow. Skeletal muscle samples were collected immediately after death was confirmed, flash frozen using liquid nitrogen, and stored at -80oC until further analysis.
2010-05-22 | E-GEOD-12502 | biostudies-arrayexpress
Project description:Mechanisms contributing to age-related cognitive decline are poorly defined. Thus, we used canine microarrays to compare gene expression profiles of brain tissue from geriatric and young adult dogs. Cerebral cortex samples were collected from 6 geriatric (12 yr-old) and 6 young adult (1 yr-old) female beagles after being fed one of two diets (animal protein-based versus plant-protein based) for 12 months. RNA samples were hybridized to Affymetrix GeneChip Canine Genome Arrays. Statistical analyses indicated that the age had the greatest impact on gene expression, with 963 transcripts differentially expressed in geriatric dogs. Although not as robust as age, diet affected mRNA abundance of 140 transcripts. As demonstrated in aged rodents and humans, geriatric dogs had increased expression of genes associated with inflammation, stress response, and calcium homeostasis and decreased expression of genes associated with neuropeptide signaling and synaptic transmission. In addition to its existing strengths, availability of gene sequence information and commercial microarrays make the canine a powerful model for studying the effects of aging on cognitive function. Keywords: age; diet Six geriatric (11.1 yr old) and 6 weanling (8 wk old) female beagles were used. Three dogs of each age were assigned to one of two dietary treatments and fed for 12 months. Diets tested in this experiment were previously shown to manipulate energy metabolism. One diet was an animal-protein based diet (APB) and was composed primarily of highly digestible ingredients and animal-derived protein and fat sources (brewer’s rice, poultry by-product meal, poultry fat) and was formulated to contain 28% protein, 23% fat, and 5% dietary fiber. The other diet was a plant-protein based diet (PPB) and was composed primarily of moderately digestible plant-derived ingredients (corn, soybean meal, wheat middlings, and meat and bone meal) and was formulated to contain 26% protein, 11% fat, and 15% dietary fiber. Although the two diets were very different in terms of ingredient and chemical composition, both were formulated to meet or exceed all nutrient requirements for canine growth according to the Association of American Feed Control Officials. Young dogs were fed ad libitum to allow for adequate growth, while geriatric dogs were fed to maintain baseline BW throughout the experiment. To produce the desired metabolic effects, the PPB diet was formulated to contain a lower caloric density (APB = 5.38 kcal/g; PPB = 4.75 kcal/g) and have a lower nutrient digestibility than the APB diet. Thus, dogs fed the PPB diet needed to consume a greater (P<0.05) quantity of food (237 g/d; 1123 kcal/d) than dogs fed the APB diet (166 g/d; 893 kcal/d) to grow (young) or maintain BW (geriatrics). Even though metabolic indices were altered, mean BW among dietary treatments was not different at any time over the course of the study for young or geriatric dogs. After 12 months on experiment, animals were fasted for 12 hr and then given a lethal dose (130 mg/kg BW) of sodium pentobarbital (Euthasol, Virbac Corp., Fort Worth, TX) intravenously into the left forearm. Death was confirmed by lack of respiration and a corneal reflex, and absence of a heartbeat detected with a stethoscope placed under the left elbow. Cerebral cortex samples were collected immediately after death was confirmed, flash frozen using liquid nitrogen, and stored at -80oC until further analysis.
2008-08-05 | E-GEOD-12328 | biostudies-arrayexpress
Project description:PolyA+ RNA from cytosol of HeLa and GM06990 cells using Affymetrix ENCODE tiling chip with NCBI build 35 annotation. PolyA+ RNA from cytosol of HeLa and GM06990 cells.
2010-06-05 | E-GEOD-3663 | biostudies-arrayexpress
Project description:Despite their different origin and function, both pollen tubes and root hairs share the same sort of apical growth mechanism, i.e., the spatially focused cell expansion at the very apex. Ion fluxes, membrane trafficking, the actin cytoskeleton and their interconnection via signaling networks have been identified as fundamental processes underlying this kind of growth. Several molecules involved in apical growth have been identified, but the genetic basis is far from being fully characterized. We have used Affymetrix Arabidopsis ATH1 GeneChips to obtain the expression profiles of isolated Arabidopsis root hairs. A comparison with the expression profile of flow-sorted pollen grains reveals an overlap in the expression of 4989 genes, which corresponds to 42% of the root hair transcriptome and 76% of the pollen transcriptome, respectively. Our comparison with transcriptional profiles of vegetative tissues by principal component analysis and hierarchical clustering shows a clear separation of these samples comprised of cell types with diffuse growth from the two cell types with apical growth. 277 genes are enriched and 49 selectively expressed, respectively, in root hairs and pollen. From this set of genes emerges an apical growth signature containing novel candidate genes for apical growth determination. Root hairs were isolated from Arabidopsis seedlings and total RNA was isolated for expression profiling on Affymetrix ATH1 arrays. The study was performed with biological duplicates.
2014-08-05 | E-GEOD-38486 | biostudies-arrayexpress
Project description:Changes in gene expression in whole Anopheles gambiae female bodies between virgin mosquitoes and females samples at 2h, 6h, and 24h after mating.
2009-01-01 | E-MEXP-1868 | biostudies-arrayexpress