Unknown,Transcriptomics,Genomics,Proteomics

Dataset Information

Single-cell RNAseq of differentiating human iPSCs during endothelial-to-hematopoietic transition with targeted CRISPR activation

ABSTRACT: This dataset contains single cell RNAseq of human iPSCs undergoing cytokine-mediated differentiation alongside targeted CRISPR-mediated endogenous gene activation. For this experiment we sequenced single cells at day 10 of the differentiation protocol, when the cells undergo the endothelial-to-hematopoietic transition described in the paper Petazzi et al, BiorXiv DOI 10.1101/2022.10.04.510611 The dataset contains four libraries: (1) iSAM line infected with non-targeting guide RNA, (2) iSAM line infected with non-targeting guide RNA treated with Dox, (3) iSAM line infected with targeting guide RNAs library, (4) iSAM line infected with targeting guide RNAs library treated with Dox

INSTRUMENT(S): NextSeq 550

ORGANISM(S): Homo sapiens

SUBMITTER: Antonella Fidanza

PROVIDER: E-MTAB-12748 | biostudies-arrayexpress |

REPOSITORIES: biostudies-arrayexpress

ACCESS DATA

Similar Datasets

Project description:Clustered regularly interspaced short palindromic repeat (CRISPR) RNA-guided nucleases have gathered considerable excitement as a tool for genome engineering. However, questions remain about the specificity of their target site recognition. Most previous studies have examined predicted off-target binding sites that differ from the perfect target site by one to four mismatches, which represent only a subset of genomic regions. Here, we used ChIP-seq to examine genome-wide CRISPR binding specificity at gRNA-specific and gRNA-independent sites. For two guide RNAs targeting the murine Snurf gene promoter, we observed very high binding specificity at the intended target site while off-target binding was observed at 2- to 6-fold lower intensities. We also identified significant gRNA-independent off-target binding. Interestingly, we found that these regions are highly enriched in the PAM site, a sequence required for target site recognition by CRISPR. To determine the relationship between Cas9 binding and endonuclease activity, we used targeted sequence capture as a high-throughput approach to survey a large number of the potential off-target sites identified by ChIP-seq or computational prediction. A high frequency of indels was observed at both target sites and one off-target site, while no cleavage activity could be detected at other ChIP-bound regions. Our results demonstrate that even a simple configuration of a Cas9:gRNA nuclease can support very specific DNA cleavage activity and that most interactions between the CRISPR nuclease complex and genomic PAM sites do not lead to DNA cleavage. ChIP-seq using dCas9 to determine genome-wide binding of CRISPR/Cas9 noED: Cas9 doublemutant protein without an effector domain KRAB: Cas9 doublemutant protein fused to the KRAB repressor domain S1 gRNA: guide RNA targeting GCTCCCTACGCATGCGTCCC(AGG) in the mouse genome S2 gRNA: guide RNA targeting AATGGCTCAGGTTTGTCGCG(CGG) in the mouse genome VEGFA TS3 gRNA: guide RNA targeting GGTGAGTGAGTGTGTGCGTG(TGG) in the human genome

Dataset Information

Single-cell RNAseq of differentiating human iPSCs during endothelial-to-hematopoietic transition with targeted CRISPR activation

Similar Datasets

OmicsDI is part of the ELIXIR infrastructure

Tweets