Unknown,Transcriptomics,Genomics,Proteomics

Dataset Information

Transcription profiling of tomato shoots and roots from plants systemically infected by TSWV reveals organ-specific transcriptional responses

ABSTRACT: Transcription profiling of roots and shoots of tomato plants as a result of systemic infection with the tospovirus Tomato Spotted Wilt Virus (TSWV).

ORGANISM(S): Solanum lycopersicum

DISEASE(S): TSWV infected

SUBMITTER: Laura Miozzi

PROVIDER: E-MTAB-133 | biostudies-arrayexpress |

REPOSITORIES: biostudies-arrayexpress

ACCESS DATA

Similar Datasets

Project description:Pseudomonas syringae pv. tomato DC3000 (Pst) is a virulent pathogen, which causes disease on tomato and Arabidopsis. The type III secretion system (TTSS) plays a key role in pathogenesis by translocating virulence effectors from the bacteria into the plant host cell, while the phytotoxin coronatine (COR) contributes to virulence and disease symptom development. Recent studies suggest that both the TTSS and and COR are involved in the suppression of host basal defenses. However, little is known about the interplay between the host gene expression associated with basal defenses and the virulence activities of the TTSS and COR during infection. The global effects of the TTSS and COR on host gene expression associated with other host cellular processes during bacterial infection are also not well characterized. In this study, we used the Affymetrix full genome chip to determine the Arabidopsis transcriptome associated with basal defense to Pst DC3000 hrp mutants and the human pathogenic bacterium Escherichia coli O157:H7. We then used Pst DC3000 virulence mutants to characterize Arabidopsis transcriptional responses to the action of hrp-regulated virulence factors (e.g., TTSS and COR) during bacterial infection. Additionally, we used bacterial fliC mutants to assess the role of the PAMP flagellin in induction of basal defense-associated transcriptional responses. In total, our global gene expression analysis identified more than 5000 Arabidopsis genes that are reproducibly regulated more than 2-fold in three independent biological replicates of at least one type of comparison. Regulation of these genes provides a molecular signature for Arabidopsis basal defense to plant and human pathogenic bacteria, and illustrates both common and distinct global virulence effects of the TTSS, COR, and possibly other hrp-regulated virulence factors during Pst DC3000 infection. Experimenter name = William Underwood; Experimenter phone = 517-353-9182; Experimenter fax = 517-353-9168; Experimenter address = Michigan State University; Experimenter address = 222 Plant Biology Building; Experimenter address = 178 Wilson R.d. Experimenter address = East Lansing, MI; Experimenter zip/postal_code = 48824; Experimenter country = USA Experiment Overall Design: 40 samples were used in this experiment

Project description:Plant and virus materials, inoculation and symptom evaluation Tomato seedlings, cultivar Tricia (De Ruiter seeds, Bergschenhoek, the Netherlands) were grown in stonewool in climate chamber conditions (22 and 20°C during day and night periods of 10 and 14 hours, respectively, at 75% relative humidity). At 29 days after planting, plants were inoculated with a mild (1906; GenBank accession number FJ457096) and an aggressive (PCH 06/104; GenBank accession number FJ457097) PepMV isolate of the CH2 genotype. Here, a PepMV isolate is defined as the viral inoculum derived from PepMV infected plants from one specific tomato production site. After inoculation, the genotype of both isolates was determined using a previously described RT-PCR-RFLP method (Hanssen et al., 2008). Inoculation was performed on the second fully developed leaf as previously described (Hanssen et al., 2008). The phenotypic response of tomato seedlings upon inoculation was evaluated by recording the development of typical nettlehead-like PepMV symptoms at 4, 8 and 12 days post inoculation (DPI) on 20 plants per treatment. PepMV induced nettlehead-like symptoms are characterized by a reduced leaf surface, leaf bubbling and leaf deformation (Hanssen et al., 2008). Symptoms were scored from 0 (no symptoms) to 3 (severe symptoms) (Figure 1b). Significant (p<0.05) differences in symptom scores were identified by analysis of variance (one-way ANOVA) and post-hoc Bonferroni tests using SPSS software (v. 10.0; SPSS Inc., Chicago, IL, USA). Microarray sample preparation and determination of viral titers Tomato genes that were differentially regulated (more than twofold change with P value < 0,001) upon inoculation with the aggressive and mild PepMV isolates were identified at 4, 8 and 12 DPI using mock-inoculated control plants as a reference. At each time point, the youngest fully developed leaves from CH2 mild, CH2 aggressive and mock-inoculated plants were sampled for tomato gene chip hybridizations. Each plant was sampled only once. Three biological replicates, each consisting of pooled RNA extracts obtained from the youngest fully developed leaves of two seedlings, were analyzed per treatment. Total RNA was extracted using the RiboPure RNA extraction kit (Ambion) and reverse transcribed with labeled oligo-dT primers for hybridization onto custom-designed Affymetrix tomato GeneChip arrays (Syngenta Biotechnology, Inc., Research Triangle Park, North Carolina, US) that contains probe sets to interrogate 22,721 tomato transcripts (Van Esse et al., 2007). Viral accumulation was measured using a PepMV-specific RT-qPCR assay with forward primer Pep5 (5' ATGAAGCATTCATACCAAAT 3') and reverse primer Pep4 (5' AATTCCGTGCACAACTAT 3'; Mumford & Metcalfe, 2001) respectively. PCR amplification was carried out using a Cepheid® Smart Cycler II thermocycler and analyzed using Smart Cycler software. The PCR program consisted of an initial denaturation step at 95°C for 15 min, 45 cycles of 15s at 94 ºC, 30 s at 50 °C and 30 s at 72 °C, followed by a final incubation step of 2 min at 72°C. Standard curves based on cDNA dilution series were generated to determine the relative concentrations of amplified viral RNA. Based on 4 replicates, run in two different analyses, a reaction efficiency of around 90% was obtained. Ct values obtained from the PepMV specific assay were standardized by subtraction from an internal control assay (efficiency 99%) amplifying a partial sequence of the ribulose 1.5-biphosphate carboxylase chloroplast gene (Sánchez-Navarro et al. 2005).

Project description:Transcriptomic analysis in response to Botrytis cinerea infections under conrasting nitrate regime Nitrogen (N) is one of the main limiting nutrients for plant growth and crop yield. It is well documented that changes in nitrate availability, the main N source found in agricultural soils, influences a myriad of developmental programs and processes including the plant defense response. Indeed, many agronomical reports indicate that the plant N nutritional status influences their ability to respond effectively when challenged by different pathogens. However, the molecular mechanisms involved in N-modulation of plant susceptibility to pathogens are poorly characterized. In this work, we show that Solanum lycopersicum defense response to the necrotrophic fungus Botrytis cinerea is affected by plant N availability, with higher susceptibility in nitrate-limiting conditions. Global gene expression responses of tomato against B. cinerea under contrasting nitrate conditions reveals that plant primary metabolism is affected by the fungal infection regardless of N regimes. This result suggests that differential susceptibility to pathogen attack under contrasting N conditions is not only explained by a metabolic alteration. We used a systems biology approach to identify the transcriptional regulatory network implicated in plant response to the fungus infection under contrasting nitrate conditions. Interestingly, hub genes in this network are known key transcription factors involved in ethylene and jasmonic acid signaling. This result positions these hormones as key integrators of nitrate and defense against B. cinerea in tomato plants. Our results provide insights into potential crosstalk mechanisms between necrotrophic defense response and N status in plants. To better understand the molecular changes underlying the impact of nitrate availability on plant susceptibility to B. cinerea, we performed plant transcriptome profiling assays on mock-treated (3 biological replicates) and infected plants ( 3 biological replicates) grown under three N conditions, using GeneChip Tomato Genome Arrays (Affymetrix).

Dataset Information

Transcription profiling of tomato shoots and roots from plants systemically infected by TSWV reveals organ-specific transcriptional responses

Similar Datasets

OmicsDI is part of the ELIXIR infrastructure

Tweets