Browse
Submit Data
Databases
API
Help

Unknown,Transcriptomics,Genomics,Proteomics

Dataset Information

48 Views

0 Connections

0 Citations

0 Reanalyses

0 Downloads

Omics score: 0

Whole genome microarray of bendiocarb-resistant An. gambiae mosquitoes from Uganda

ABSTRACT: Identification of genes associated with bendiocarb resistance. Mosquitoes collected as larvae from Nagongera and Kihihi, Uganda. Bendiocarb-resistant and unexposed female mosquitoes selected using standard WHO tube bioassays. RNA was extracted from pools of five individuals identified as An. gambiae s.s. Insecticide-susceptible mosquitoes from the Kisumu strain were included as controls. RNA hybridized in an interwoven loop design to compare four biological replicates each of resistant, unexposed, and laboratory mosquitoes.

ORGANISM(S): Anopheles gambiae S

SUBMITTER: Alison Isaacs

PROVIDER: E-MTAB-6280 | biostudies-arrayexpress |

REPOSITORIES: biostudies-arrayexpress

ACCESS DATA

Json Xml

Similar Datasets

Transcription profiling of Anopheles gambiae midgut and fat bodies 1 and 11 days post Plasmodium berghei infection to investigate responses in detoxification genes

Project description:Detoxification genes were assayed for their response to Plasmodium berghei infection at 1 and 11 days post infection in Anopheles gambiae mosquitoes.

2010-08-11 | E-MTAB-195 | biostudies-arrayexpress

Lambda-cyhalothrin resistance in Anopheles gambiae from Tororo, Uganda

Project description:Anopheles gambiae isofemale families from Tororo, Uganda were assayed for resistance to lambda-cyhalothrin (1.5hr exposure). Resistant families were compared to susceptible families. A portion of each family was exposed to 0.05% lambda-cyhalothrin in order to determine the family phenotype. The families used for the array were of known phenotype but were themselves unexposed.

2013-12-03 | E-MTAB-1874 | biostudies-arrayexpress

Serratia_infections

Project description:Transcriptional responses in the gut of the main malaria vector Anopheles gambiae following oral bacterial infection with the entomopathogen Serratia marcescens were identified using DNA microarrays. S. marcescens is a common member of the mosquito gut microbiota, found in both laboratory reared and field collected mosquitoes, that can be potentially pathogenic as in Drosophila (Nehme et al., 2007), while it has been shown to influence the outcome of Plasmodium infections (Bando et al., 2013). S. marcescens belongs to the Enterobacteriaceae family, members of which have been shown to influence malaria transmission dynamics (Cirimotich et al., 2011, Boissiere et al., 2012). To further investigate the interactions between S. marcescens and the mosquito host, likely to shape, directly or indirectly, malaria transmission dynamics, An. gambiae mosquitoes, from the recently established N'gousso M form laboratory colony that retains much of the genetic variation of field mosquitoes, were antibiotic treated for 5 days and subsequently orally infected with the Db11-GFP strain of S. marcescens. Bacteria-fed mosquitoes were selected 2 days post infection, and, 3 days post infection, guts from bacteria-fed mosquitoes were dissected. Uninfected control mosquitoes were treated in the same way. Differential expression in the gut of S. marcescens infected mosquitoes, compared to uninfected controls, was identified by hybridizing labelled complementary RNA, derived from total RNA extracted from the respective gut pools, in customized Agilent 4x44k gene expression microarrays, comprising oligonucleotide probes encompassing all An. gambiae annotated genes of the AgamP3.6 release, with each probe represented in duplicate.

2013-11-30 | E-MEXP-3952 | biostudies-arrayexpress

Expression data from the mosquito Anopheles gambiae midgut 3h after a protein meal with or without E. coli.

Project description:The Anopheles gambiae midgut harbors bacteria that proliferate upon a blood feed. We used microarrays to examine the midgut gene expression response at early stages (3hours) after an artifitial meal containing heat killed bacteria. Anopheles gambiae G3 mosquitoes 5-6 day-old were fed BSA (20% in PBS with fresh 10 mM sodium bicarbonate) with or without heat killed E. coli (equivalent of 2.5 ml of 0.8 OD) . Three pools of 10 mosquito midguts were dissected after 3h and processed for microarray analysis of gene expression.

2010-02-21 | E-GEOD-20204 | biostudies-arrayexpress

CpG Oligodeoxynucleotides treatment of Anopheles mosquitoes

Project description:In the present study, we have investigated the effect of CpG Oligodeoxynucleotides (CpG-ODN) on the outcome of Plasmodium infection of the mosquito vectors Anopheles stephensi and Anopheles gambiae and on the modulation of mosquito immunity to Plasmodium. Anopheles mosquitoes inoculated with CpG-ODN showed significant reduction of Plasmodium infection rate and intensity. Microarrays were used to profile transcription of fat-body from CpG-ODN-treated mosquitoes. Mosquitoes were dissected 18h after ODN inoculation (immediately before feeding). Batches of 20 to 30 fat bodies (abdomen without midgut, ovaries and malpighian tubule]) were dissected in cold DEPC-treated phosphate-buffered saline (PBS) and processed for RNA preparation. Mosquitoes treated with CpG-ODNs are less susceptible to Plasmodium infection. Transcription profile of fat body indicates that protection was associated with coagulation/wound healing, while melanization appears to be depressed. Anopheles gambiae s.s. mosquitoes were reared at 25 M-BM-:C and 75% humidity with a 12-hour light/dark cycle. Adult mosquitoes were maintained on a 10% glucose solution. Three- to four-day-old female mosquitoes were cold-anaesthetized and inoculated intratoraxically with 69nl of a 0.1mM CpG-oligodeoxynucleotide (0604 -5M-bM-^@M-^Y TCCATGACGTTCCTGATGCT 3M-bM-^@M-^Y) solution or with the same volume of elution buffer using a Nanoject micro-injector (Drummond Scientific). Mosquitoes were left to rest for 18h. Batches of 20 to 30 fat bodies (abdomen without midgut, ovaries and malpighian tubule) were dissected in cold DEPC-treated phosphate-buffered saline (PBS) and processed for RNA preparation. Two independent experiments were performed for each treatment.

2013-04-02 | E-GEOD-26941 | biostudies-arrayexpress

Anopheles funestus amidst a South/North shift in the role of key resistance genes across Malawi

Project description:Resistance to pyrethroids, the only insecticide approved for bednets, threatens control of the major malaria vector, Anopheles funestus, in Malawi. To improve the management of such resistance countrywide, it is crucial to understand the dynamics and mechanisms driving resistance in the field. In this study the levels of insecticide resistance were determined across the highly endemic densely populated lake and southern agricultural area. Insecticide resistance to pyrethoids was assessed using standardized WHO bioassay methods and resistant mosquitoes were hybridized to susceptible mosquitoes. This microarray analysis revealed the key role of cytochrome P450 genes such as CYP6P9a, CYP6P9b and CYP6M7. However, a significant shift in the over-expression of these CYP450s was detected across a south/north transect, with CYP6M7 more highly over-transcribed in the two northern collection sites and the tandemly duplicated genes, CYP6P9a and CYP6P9b, more greatly over-transcribed in the south.

2016-02-12 | E-MTAB-3342 | biostudies-arrayexpress

Serratia_SNP1

Project description:Anopheles gambiae mosquitoes of the M form N'gousso laboratory colony were antibiotic treated and subsequently orally infected with the Db11-GFP fluorescent strain of Serratia marcescens. Bacteria-fed mosquitoes were separated 2 days post infection based on the presence in the mosquito gut of a dye contained in the sugar solution. Mosquitoes were dissected 5 days post infection and the level of S. marcescens infection was determined through microscopic observation of mosquito guts under a fluorescence microscope. Highly infected mosquitoes, with an extensive presence of fluorescent S. marcescens throughout their gut and non-infected mosquitoes, with no sign of fluorescence traced in their gut, were further used for SNP genotyping. Genomic DNA from pools of 15 highly infected and 15 non-infected mosquitoes, in equimolar amounts, was hybridized in a customized Affymetrix 400k SNP genotyping arrays, interrogating genetic variation at ~400,000 variable positions in the An. gambiae genome, as determined by a previous sequencing effort of M/S An. gambiae molecular forms. Allele calls in both array hybridizations were used to determine the minor allele frequency difference for each individual SNP between the two phenotypic pools, which were subsequently used to determine loci associated with the outcome of S. marcescens infection.

2013-11-30 | E-MEXP-3951 | biostudies-arrayexpress

Transcription profiling by array of wounded and non-wounded Anopheles gambiae mosquitoes to investigate genes regulated by wounding

Project description:We aimed at identifying the genes regulated by wounding in Anopheles gambiae. Gene expression was compared between wounded and non-wounded mosquitoes, 3h after wounding. Wounding was induced by the injection of dsLacZ using a thin glass needle.

2013-06-05 | E-MEXP-3677 | biostudies-arrayexpress

Transcription profiling of Bendiocarb resistance in Anopheles funestus

Project description:Transcription profilling of Bendiocarb resistance in An.funestus

2016-06-06 | E-MTAB-3745 | biostudies-arrayexpress

Transcription profiling of bendiocarb resistance in Anopheles funestus

Project description:Transcription profiling of bendiocarb resistance in Anopheles funestus

2016-06-01 | E-MTAB-3747 | biostudies-arrayexpress