Transcriptome profiling of human pre-B ALL cell line 697 upon PBX1 or TCF3 knockdown (RNA-seq)
Ontology highlight
ABSTRACT:
INSTRUMENT(S): Illumina HiSeq 2000
ORGANISM(S): Homo sapiens
SUBMITTER: Yu-Ling Lee
PROVIDER: E-MTAB-8179 | biostudies-arrayexpress |
REPOSITORIES: biostudies-arrayexpress
Similar Datasets
Project description:Background: Histone post-translational modifications (PTMs) constitute a branch of epigenetic mechanisms that can control the expression of eukaryotic genes in a heritable manner. Recent studies have identified several PTM-binding proteins containing diverse specialized domains whose recognition of specific PTM sites leads to gene activation or repression. Here, we present a high-throughput proteogenomic platform designed to characterize the nucleosomal make-up of chromatin enriched with a set of histone PTM-binding proteins known as histone PTM readers. We support our findings with gene expression data correlating to PTM distribution. Results: We isolated human mononucleosomes bound by the bromodomain-containing proteins Brd2, Brd3 and Brd4, and by the chromodomain-containing heterochromatin proteins HP1alpha and HP1beta. Histone PTMs were quantified by mass spectrometry (ChIP-qMS), and their associated DNAs were mapped using deep sequencing. Our results reveal that Brd- and HP1-bound nucleosomes are enriched in histone PTMs consistent with actively transcribed euchromatin and silent heterochromatin, respectively. Data collected using RNA-Seq (GSM301568) show that Brd-bound sites correlate with highly expressed genes. In particular, Brd3 and Brd4 are most enriched on nucleosomes located within HOX gene clusters, whose expression is reduced upon Brd4 depletion by shRNA. Conclusions: Proteogenomic mapping of histone PTM readers, alongside the characterization of their local chromatin environments and transcriptional information, should prove useful for determining how histone PTMs are bound by these readers and how they contribute to distinct transcriptional states. Comparison of Brd2 and HP1b shRNA knockdown HEK293 cells to control knockdown HEK293 cells.
2012-07-30 | E-GEOD-39580 | biostudies-arrayexpress
Project description:Cooperative dependencies between mutant oncoproteins and wild-type proteins are critical in cancer pathogenesis and therapy resistance. Although spleen tyrosine kinase (SYK) has been implicated in hematologic malignancies, it is rarely mutated. We used kinase activity profiling to identify collaborators of SYK in acute myeloid leukemia (AML) and determined that FMS-like tyrosine kinase 3 (FLT3) is transactivated by SYK via direct binding. Highly activated SYK is predominantly found in FLT3-ITD positive AML and cooperates with FLT3-ITD to activate MYC transcriptional programs. FLT3-ITD AML cells are more vulnerable to SYK suppression than FLT3 wild-type counterparts. In a FLT3-ITD in vivo model, SYK is indispensable for myeloproliferative disease (MPD) development, and SYK overexpression promotes overt transformation to AML and resistance to FLT3-ITD-targeted therapy. HL-60, MOLM-14, and U937 cell lines were transduced in triplicate with a control luciferase-directed shRNA (target sequence CCTAAGGTTAAGTCGCCCTCG), and in duplicate with two SYK-directed shRNAs: shSYK_1 (clone ID TRCN0000197257, target sequence GCAGCAGAACAGACATGTCAA) and shSYK_2 (clone ID TRCN0000003163 , target sequence GCAGGCCATCATCAGTCAGAA), and were then selected with 1 µg/ml puromycin 48 hours post-infection. At day 5 post-infection, RNA was extracted and profiled using HT HG-U133A arrays (Affymetrix) at the Broad Institute (Cambridge, MA, USA). The computational analysis of the gene expression data was performed through the Genome Space bioinformatics platform (http://www.genomespace.org).
2014-01-15 | E-GEOD-54065 | biostudies-arrayexpress
Project description:Amplification of a ~2.5 megabase region on chromosome 9p24 is frequent in both primary mediastinal B-cell lymphoma (PMBL) and Hodgkin's lymphoma (HL). To identify the oncogenic genes in this interval, we created a RNA interference library targeting amplicon genes. A genetic screen using this library identified three genes that are essential for the proliferation and survival of PMBL and HL lines with this amplicon, which encode the kinase JAK2, the histone demethylase JMJD2C and a gene of unknown function, RANBP6. Inhibition of JAK2 and JMJD2C cooperated in killing these lymphomas and in remodeling their chromatin by globally increasing trimethylation of lysine 9 on histone H3 (H3K9me3) and heterochromatin formation. JAK2 and JMJD2C inhibition silenced MYC and its target genes, which coincided with an increase in H3K9me3 and the heterochromatin protein HP1alpha at the MYC locus. We conclude that amplification of JAK2 and JMJD2C cooperatively reprograms the PMBL and HL epigenome, sustaining their survival and proliferation. Signal from untreated shRNA cells or DMSO control cells (Cy3) was compared to 4 dox-treated JAK2 shRNA cells, 4 dox-treated JMJD2C shRNA cells, or 8 JAK2 inhibitor-treated cells (Cy5).
2011-01-04 | E-GEOD-20988 | biostudies-arrayexpress
Project description:10plex TMT labelling quantification expriments were performed to access the knockdown effect of YTHDF1 in cells.3 shGFPs control samples, 3 YTHDF1 shRNA-2 knockdown samples , 3 YTHDF1 shRNA-3 knockdown samples and 1 mixture sample were labelled by TMT 10-plex reagents.
2019-09-27 | PXD015182 | Pride
Project description:Stable knockdown of NET1, a RhoGEF, was achieved in AGS Gastric Cancer cells. This gene is known to be overexpressed in the disease. Knockdown was achieved using lentiviral shRNA particles. Gene expression was compared between knockdown and scrambled shRNA treated control cells. Cells were treated with and without LPA, a known activator of RhoA. Three distinct cell lines were used in this study (all AGS cells); (i) Non Target cell (NT) stably expressing non targetting shRNA (ii) 63 and (iii) 65; the latter two are stable NET1 knockdown cells and are seperatly transduced with separate NET1 targetting shRNA particles. Cells were treated with and without 10microM LPA for 4 hr. Experimental replicates were performed for each treatment (A & B), RNA was prepared from each and seperatly hybridised to U133A arrays.
2011-01-02 | E-GEOD-26309 | biostudies-arrayexpress
Project description:The histone H3 lysine 9 (H3K9) methyltransferase Eset is an epigenetic regulator critical for the development of the inner cell mass (ICM). Although ICM-derived embryonic stem (ES) cells are normally unable to contribute to the trophectoderm (TE) in blastocysts, we find that depletion of Eset by shRNAs leads to differentiation with the formation of trophoblast-like cells and induction of trophoblast-associated gene expression. Using ChIP-seq analyses, we identified Eset target genes with Eset-dependent H3K9 trimethylation. We confirmed that genes that are preferentially expressed in the TE (Tcfap2a and Cdx2) are bound and repressed by Eset. Single cell PCR analysis shows that the expression of Cdx2 and Tcfap2a is also induced in Eset-depleted morula cells. Importantly, Eset-depleted cells can incorporate into the TE of a blastocyst and subsequently placental tissues. Co-immunoprecipitation and ChIP assays further demonstrates that Eset interacts with Oct4, which in turn recruits Eset to silence these trophoblast-associated genes. Our result suggests that Eset restricts the extraembryonic trophoblast lineage potential of pluripotent cells and links an epigenetic regulator to key cell fate decision through a pluripotency factor. Keywords: Epigenetics Examine Eset-binding sites and compare the H3K9me3 state between Eset knockdown mouse ES cells and control knockdown mouse ES cells.
2009-11-04 | E-GEOD-17642 | biostudies-arrayexpress
Project description:This experiment seeks to ascertain the transcriptional changes in the adult mouse hippocampus (CA1 subregion) that occur following viral knockdown of the histone variant H2A.Z. We are especially interested in understanding the role of this histone variant in memory formation and memory maintenance in the adult central nervous system. This experiment includes 3 groups, each with 3 biological replicates. Samples S108, S109, and S110 are from controls infected with an AAV expressing a scrambled shRNA control. Samples A100, A101, A102, A104, A106, and A107 were infected with an AAV expressing an shRNA against H2A.Z. Samples A100, A101, and A102 were naive animals, whereas samples A104, A106, and A107 were trained in contextual fear conditioning.
2014-09-09 | E-GEOD-58797 | biostudies-arrayexpress
Project description:Sub-genomewide shRNA libraries were constructed using the current RNAi consortium constructs as well as using the DSIR (siRNA algoirthm) and a novel shRNA specific algorithm (shERWOOD). All libraries were placed into mir30 expression vectors. The shERWOOD libraries were also placed in a vector harboring an optimized mir cassette (ultramir). Each library was screened using the pancreatic cell line A385. A concensus set of essential genes identified as the set for which two shRNAs depleted in each of the libries. For these genes, a great percentage of shERWOOD seletected shRNA depleted. In addition the placement of shERWOOD selected constructs into ultramir scaffoled increased the rate of shRNA depletion for essential genes further. Purpose: shRNA screens were carried out using various library construction strategies to identify the strategy that provides the best shRNA screening results. Method: Libraries were constructed using the TRC shRNA set as well as shRNAs identified using the DSIR and shERWOOD algorithms. shRNA libraries were cloned into mir30 expression vectors. shERWOOD shRNAs were also cloned into an expression vector harboring an optimized microRNA scaffold termed ultramir. Each resultant library was screened using the pancreatic cell line A385. Each library was analyzed separately to identify a set of genes where at least two shRNAs depleted. These gene sets were intersected to develop a set of essential genes. Results: The shERWOOD shRNA libraries provided the highest number depleting shRNAs for each essential gene. Further these shRNAs depleted to a greater extent than did the shRNAs from the other libraries. When shERWOOD libraries were placed into the ultramir cassette a greater number of shRNAs per essential gene depleted.
2014-11-24 | E-GEOD-62185 | biostudies-arrayexpress
Project description:Transcriptional profiling of primary human white preadipocytes after infection with lentiviral vector either containing shRNA directed against dipeptidypeptidase 4 (DPP4) or unspecific shRNA as negative control Treatment of cells with DPP4 shRNA or control shRNA was done in 4 biological replicates, the first sample of DPP4 KD was hybridized against the first sh-control sample, the second DPP4 smple against the second control sample and so on
2015-11-24 | E-GEOD-75328 | biostudies-arrayexpress
Project description:The remarkable molecular heterogeneity in hepatocellular carcinoma (HCC) continues to challenge development of effective treatments and biomarkers. Here we report that the gene encoding a secreted glycoprotein, ADAMTSL5, is overexpressed and displays hypermethylated CpG islands in its gene body region in a clinically relevant mouse genetic model of HCC as well as in a significant proportion of human HCC patients. Immunohistological analysis of human HCCs revealed strong ADAMTSL5 immunostaining in tumour cells and histiocytes, in contrast to normal liver. Functional targeting of ADAMTSL5 in oncogenesis using shRNA interfered with tumorigenic properties of HCC cells both in vitro and in vivo. Furthermore, ADAMTSL5 overexpression conferred tumorigenic capability to genetically sensitized, non-transformed hepatocytes in nude mice. Mechanistically, ADAMTSL5 abrogation led to reduction of several oncogenic inputs, including the receptor tyrosine kinases MET, EGFR, PDGFRβ, IGF1Rβ, and FGFR4, suggesting it as a master regulator of HCC tumorigenicity when overexpressed.
2020-11-17 | PXD016634 | Pride