Browse
Submit Data
Databases
API
Help

Unknown,Transcriptomics,Genomics,Proteomics

Dataset Information

47 Views

0 Connections

0 Citations

0 Reanalyses

0 Downloads

Omics score: 0

Transcription profiling of Arabidopsis thaliana leaves as reaction to caterpillar (Trichoplusia ni) feeding and fungi (Laccaria bicolor) infection of the roots

ABSTRACT: Arabidopsis thaliana plants were grown from seeds. Roots of 9 day old plants were inoculated with L. bicolor. After 4 weeks, two T. ni larvae per plant fed for 24 h. Leaves were subsequently harvested, shock frozen in liquid nitrogen and prepared for RNA extraction

INSTRUMENT(S): Illumina HiSeq 2000

ORGANISM(S): Arabidopsis thaliana

SUBMITTER: Kishore Vishwanathan

PROVIDER: E-MTAB-8523 | biostudies-arrayexpress |

REPOSITORIES: biostudies-arrayexpress

ACCESS DATA

Json Xml

Similar Datasets

Transcription profiling of Populus x canescens developing and mature xylem under short-days and drought stress treatment

Project description:Populus x canescens were kept in climate chambers for a growing period of 8 weeks. Afterwards, treatment started for five weeks in total. Plant were first treated with different daylength (long-days or short-days) under well-watered conditions. After 2 weeks, half of each daylength treatment was drought stressed while the other half was still well-watered. After further three weeks, all poplars were harvested and samples of developing and mature xylem were taken and directly frozen in liquid nitrogen. These samples were taken for RNA extraction and following RNA-sequencing.

2018-10-21 | E-MTAB-7288 | biostudies-arrayexpress

Transcription profiling of Arabidopsis thaliana leaves as reaction to fungi (Laccaria bicolor) infection of the roots

Project description:Arabidopsis thaliana plants were grown from seeds. Roots of 7 day old plants were inoculated with L. bicolor. After 2 days, leaves were harvested, shock frozen in liquid nitrogen and prepared for RNA extraction

2020-06-30 | E-MTAB-8544 | biostudies-arrayexpress

Transcription profiling of Arabidopsis thaliana roots and leaves in reaction to fungal (Laccaria bicolor) volatiles

Project description:Arabidopsis thaliana plants were grown from seeds in Petri dishes on MS medium. 4 days old plants were co-incubated with L. bicolor without physical contact. Roots were harvested after 0, 2, 4 and 7 days of co-incubation, rosette leaves were harvested after 4 days of co-incubation.

2020-12-10 | E-MTAB-8684 | biostudies-arrayexpress

Global variation of gene expression induced by constitutive activation of the NIK receptor in Arabidopsis

Project description:Arabidopsis was transformed with the NIK receptor or the mutant T474D NIK receptor and infected with CaLCuV. The global variation of gene expression was analysed by RNA-seq at 10 days post inoculation and 20 days post inoculation and differential gene expression was determinated in comparison with mock inoculated Arabidopsis lines. Pairwise comparison between mock inoculated and infected genotypes (WT,NIK-expressing lines and T474D-expressing lines) at 10 dpi and 20 dpi

2014-04-21 | E-GEOD-56922 | biostudies-arrayexpress

Genome-wide sequencing small RNAs in response to powdery mildew and heat stress in wheat

Project description:To test whether non-coding RNAs play roles in regulating response to powdery mildew infection and heat stress in wheat, by using Solexa high-throughput sequencing and computational analysis and experimental approach we cloned the small RNAs and identified 125 putative long npcRNAs from wheat leaves infected by preponderant physiological strain Erysiphe graminis f. sp. tritici (Egt) or by heat stress treatment. Among long non-coding RNAs, some were precursors of small RNAs such as microRNAs and siRNAs, two long npcRNAs were identified as signal recognition particle (SRP) 7S RNA variants, and three were characterized as U3 snoRNAs. Wheat long npcRNAs showed tissue dependent expression patterns and were responsive to powdery mildew infection and heat stress. Examination non-coding RNAs of 2 near isogenic lines 8866 (Susceptible) and Pm30 (Resistant) in response to powdery milew and two genotypes CK (insensitive) and TAM107 (insensitive) to heat. CK and TAM107 represent the same material in different treatments (no heat stress or 1hour after heat stress).

2011-02-15 | E-GEOD-27327 | biostudies-arrayexpress

To russet or not to russet: MdMyb93 as a regulator of suberin deposition in apple fruits

Project description:â¢ A comparison of the transcriptomes of russeted vs. waxy apple exocarps previously highlighted a tight relationship between a gene encoding a MYB-type transcription factor, MdMYB93, and some key suberin biosynthetic genes. The present work assesses the role of this transcription factor in the suberization process. â¢ A phylogenetic analysis of MdMYB93 and Arabidopsis thaliana MYBs was performed and the function of MdMYB93 was further investigated using Agrobacterium-mediated transient overexpression in Nicotiana benthamiana leaves. An RNA-Seq analysis was performed to highlight the MdMYB93-regulated genes. UPLC-TripleTOF and GC-MS were used to investigate alterations in phenylpropanoid, soluble free lipid, and lipid polyester contents. â¢ A massive accumulation of suberin and its biosynthetic precursors in MdMYB93 agro-infiltrated leaves was accompanied by a remobilization of phenylpropanoids and an increased amount of lignin precursors. Gene expression profiling displayed a concomitant alteration of lipid and phenylpropanoid metabolism, cell wall development, and extracellular transport, with a large number of induced transcripts predicted to be involved in suberin deposition. â¢ The present work supports a major role of MdMYB93 in the regulation of suberin deposition in russeted apple skins, from the synthesis of monomeric precursors, their transport, polymerization, and final deposition as suberin in primary cell wall. In order to draw a consistent picture of a gene expression profile of the MYB93 induced was performed comparing of 4 biological replicates of Nicotiana benthamiana leaves infiltrated with Pearleygate103 35S::MdMYB93 and 4 biological replicates of control plants infiltrated with P19 only.

2016-07-15 | E-GEOD-83618 | biostudies-arrayexpress

Arabidopsis resistance to the Fungal Pathogen Drecslera gigantea in WT and bzip28 bzip60 mutant plants: the role of the Unfolded Protein Response (UPR) mechanism

Project description:Quantitative proteomic experiments were performed on tryptic digests of proteins purified from the leaves of Arabidopsis thaliana. Wild type plants were compared to bzip28 bzip60 mutant plants. WT and bzip28 bzip60 mutant plants were infected with Drecslera gigantea and compared to non¬-infected control plants

2021-09-09 | PXD018099 | Pride

Leaf transcriptomes of Arabidopsis thaliana colonized by representative phyllosphere commensals alone and in combination with the pathogen Pseudomonas syringae DC3000

Project description:Plants are colonized by a variety of microorganisms, the plant microbiota. In the phyllosphere, the above-ground parts of plants, bacteria are the most abundant inhabitants. Most of these microorganisms are not pathogenic and the plant responses to commensals or to pathogen infection in the presence of commensals are not well understood. We report the Arabidopsis leaf transcriptome after 3 to 4 weeks of colonization by Methylobacterium extorquens PA1 and Sphingomonas melonis Fr1, representatives of two abundant genera in the phyllosphere, compared to axenic plants. In addition, we also sequenced the transcriptome of Arabidopsis 2 and 7 days after spray-infection with a low dose of P. syringae DC3000 and in combination with the commensals.

2016-06-05 | E-MTAB-4683 | biostudies-arrayexpress

Analysis of soybean DNA methylomes shows CHH hypermethylation enhances gene expression in cotyledons of developing seeds [methylome]

Project description:Cytosine methylation is an important mechanism for dynamical regulation of gene expression and transposon mobility during plant developmental processes. Recently, the variation of DNA methylation has been described between wild type and DNA methylation-related mutants in Arabidopsis thaliana. However, the elaborate representation of soybean DNA methylomes remains lacking. Here, we described the epigenome maps of soybean root, stem, leaf, and cotyledon of developing seed at a single-base resolution. We confirmed the transcription start sites of genes using high-throughput sequencing and reported the DNA methylation patterns in gene and transposon regions. The correlation between gene expression and DNA methylation was revealed through transcriptome sequencing. We found CHH methylation may function in promotion of gene expression and ten cotyledon-preferred genes were identified CHH hypermethylated in cotyledon. Small RNA library sequencing showed that DNA methylation was enhanced by small RNAs not by strand-specific way, and the variation of DNA methylation between the organs was highly related with expression of small RNAs. methylomes of roots, stems, leaves, and cotyledons of developing seeds

2012-10-30 | E-GEOD-34849 | biostudies-arrayexpress

Roles and Programming of Arabidopsis ARGONAUTE Proteins During Turnip Mosaic Virus Infection

Project description:AGO protein immunoprecipitation was combined with high-throughput sequencing of associated small RNAs. AGO2, AGO10, and to a lesser extent AGO1 were shown to associate with siRNAs derived from silencing suppressor (HC-Pro)-deficient TuMV-AS9, but not with siRNAs derived from wild-type TuMV. Co-immunoprecipitation and small RNA sequencing revealed that viral siRNAs broadly associated with wild-type HC-Pro during TuMV infection. These results support the hypothesis that suppression of antiviral silencing during TuMV infection, at least in part, occurs through sequestration of virus-derived siRNAs away from antiviral AGO proteins by HC-Pro. Catalytic mutant HA-AGO1-DAH, HA-AGO2-DAD and HA-AGO10-DAH or catalytically active HA-AGO10-DDH were immunoprecipitated from buffer (mock) or inoculated rosette leaves (at 7 dpi) or noninoculated cauline leaves at 10 dpi with wt TuMV or suppressor-deficient TuMV-AS9. Inflorescence from TuMV infected plants was collected at 10 dpi with wt TuMV. HC-Pro was tagged with 6xHIS in TuMV-HIS and suppressor-deficient TuMV-HIS-AS9. HC-Pro was immunoprecipitated from noninoculated cauline leaves of inflorescence at 10 dpi. HC-Pro AS9 was immunoprecipitated from noninoculated cauline leaves at 15 dpi. Total RNA was extracted from input fraction and small RNAs separated by size fractionation. Small RNAs in input and HA-AGO or HC-Pro immunoprecipitation fractions were converted to DNA Amplicons by 5' (GUUCAGAGUUCUACAGUCCGACGAUC) or 3’ (CTGTAGGCACCATCAAT) adaptor ligation followed by RT-PCR. DNA Amplicons were sequenced using the Illumina HiSeq2000 platform. Duplicate libraries were made per treatment. For each library, hits to TuMV, to TuMV-HIS and to Arabidopsis thaliana were included in separate files.

2015-04-06 | E-GEOD-64911 | biostudies-arrayexpress

OmicsDI is part of the ELIXIR infrastructure

OmicsDI is an Elixir interoperability service. Learn more ›

Tweets

OmicsDI Databases

PRIDE
PeptideAtlas
MassIVE
JPOST Repository
Physiome Model Repository

EGA
EVA
ENA
LINCS
PAXDB
Cell Collective

MetaboLights
Metabolomics Workbench
MetabolomeExpress
GNPS
BioModels
FAIRDOMHub

ArrayExpress
dbGaP
ExpressionAtlas
GEO
NODE

Information

Databases
Help
API
Contact us
Code on GitHub
Terms of use
Submit Data