Browse
Submit Data
Databases
API
Help

Metabolomics,Unknown,Transcriptomics,Genomics,Proteomics

Dataset Information

33 Views

0 Connections

0 Citations

0 Reanalyses

0 Downloads

Omics score: 0

Transcription profiling of the role of Suz12 in mouse hematopoietic progenitors

ABSTRACT: Comparison of Gene Expression in Wild type to Erg Mld2/+ Lin-Sca1+Kit+ cells

ORGANISM(S): Mus musculus

SUBMITTER: Carolyn de Graaf

PROVIDER: E-TABM-380 | biostudies-arrayexpress |

REPOSITORIES: biostudies-arrayexpress

ACCESS DATA

Json Xml

Publications

Polycomb repressive complex 2 (PRC2) restricts hematopoietic stem cell activity.

Majewski Ian J IJ Blewitt Marnie E ME de Graaf Carolyn A CA McManus Edward J EJ Bahlo Melanie M Hilton Adrienne A AA Hyland Craig D CD Smyth Gordon K GK Corbin Jason E JE Metcalf Donald D Alexander Warren S WS Hilton Douglas J DJ

PLoS biology 20080401 4

Polycomb group proteins are transcriptional repressors that play a central role in the establishment and maintenance of gene expression patterns during development. Using mice with an N-ethyl-N-nitrosourea (ENU)-induced mutation in Suppressor of Zeste 12 (Suz12), a core component of Polycomb Repressive Complex 2 (PRC2), we show here that loss of Suz12 function enhances hematopoietic stem cell (HSC) activity. In addition to these effects on a wild-type genetic background, mutations in Suz12 are s ...[more]

PMID: 18416604

Similar Datasets

Jarid2 regulates hematopoietic stem cell function by acting with Polycomb Repressive Complex 2

Project description:Polycomb Repressive Complex 2 (PRC2) has been shown to play a key role in hematopoietic stem and progenitor cell (HSPC) function. Analyses of mouse mutants harboring deletions of core components have implicated PRC2 in fine-tuning multiple pathways that instruct HSPC behavior, yet how PRC2 is targeted to specific genomic loci within HSPCs remains unknown. Here we use shRNA-mediated knockdown to survey the function of known PRC2 accessory factors in HSPCs by testing the competitive reconstitution capacity of transduced murine fetal liver cells. We find that similar to the phenotype observed upon depletion of core subunit Suz12, depleting Jarid2 enhances the competitive transplantation capacity of both fetal and adult, mouse and human HSPCs. Gene expression profiling revealed common Suz12 and Jarid2 target genes that are enriched for the H3K27me3 mark established by PRC2. These data implicate Jarid2 as an important component of PRC2 that has a central role in coordinating HSPC function. RNA-seq of jarid knockdown, suz knockdown and control from HSPC in 16 week old mice.

2015-04-02 | E-GEOD-60808 | biostudies-arrayexpress

Expression data from Control or ShSuz12 rat Intestinal epithelial cells IEC-6

Project description:Polycomb-group proteins form multimeric protein complexes involved in transcriptional silencing. The Polycomb Repressive complex 2 (PRC2) contains the Suppressor of Zeste-12 protein (Suz12) and the histone methyltransferase Enhancer of Zeste protein-2 (Ezh2). This complex, catalyzing the di- and tri-methylation of histone H3 lysine 27, is essential for embryonic development and stem cell renewal. However, the role of Polycomb-group protein complexes in the control of the intestinal epithelial cell (IEC) phenotype is not known. We investigated the impact of Suz 12 depletion on gene expression in IEC-6 cells. Multiple shRNA lentiviral constructs were tested in IEC-6 cells for their ability to down-regulate Suz12 expression (MISSION shRNA lentiviral transduction particles, SigmaM-bM-^@M-^SAldrich Canada, Oakville, ON). Forty percent confluent cells were infected in medium supplemented with 4 mg/ml polybrene (SigmaM-bM-^@M-^SAldrich Canada) for 6 h. Two days after infection, cell populations were selected with 2 mg/ml puromycin (SigmaM-bM-^@M-^SAldrich Canada). The clone TRCN0000038728 was selected: the shRNA against Suz12 (GCTGACAATCAAATGAATCAT) is conserved in rat (accession number FM084383), murine (accession number NM_199196) and human (accession number NM_015355.2) Suz12 sequences. Efficiency of infection was estimated at 25%. Control or ShSuz12 IEC-6 cell total RNAs were isolated with the Rneasy kit (Qiagen, Mississauga, ON, Canada), according to the manufacturerM-bM-^@M-^Ys instructions. RNA samples from three independent experiments were used for microarray analysis.

2014-08-02 | E-GEOD-60003 | biostudies-arrayexpress

Transcription profiling of mouse lymphoblasts from animals treated with vehicle or SAHM1

Project description:NOTCH proteins regulate signaling pathways involved in cellular differentiation, proliferation and death. Overactive Notch signaling as been observed in numerous cancers and has been extensively studied in the context of T-cell acute lymphoblastic leukemia (T-ALL) where more than 50% of pateints harbour mutant NOTCH1. Small molecule modulators of these proteins would be important for understanding the role of NOTCH proteins in malignant and normal biological processes. We were interested to measure the global gene expression changes in leukemic cells isolated from mice harbouring a NOTCH1-driven genetically engineered T-cell leukemia after treatment with SAHM1, a synthetically stabilized Î±-helical peptide derived from the MAML1 co-activator protein. Experiment Overall Design: A genetically engineered murine model of NOTCH1-driven T-ALL was developed by retroviral transduction of murine bone marrow with a mutant NOTCH1 allele commonly observed in human T-ALL patients. Transplantation of transduced cells gave rise to T-ALL that was quantifiable by bio-luminescence in our model. After established leukemia was evident by continually increased tumor burden (luminescence) mice were either treated with vehicle alone (5% DMSO in Hank's buffered saline solution) or SAHM1 (30 mg/kg, twice daily, intraperitoneal injection). After five days of treatment, mice receiving SAHM1 had a significant decrease in tumor growth. To measure a pharmacodynamic effect on Notch signaling, circulating lymphoblasts were collected from vehicle- (n=3) and SAHM1-treated (n=3) mice and gene expression profiles were generated.

2009-11-28 | E-GEOD-18351 | biostudies-arrayexpress

Loss of cohesin in vivo alters adult stem cell homeostasis leading to myeloproliferative neoplasms

Project description:This SuperSeries is composed of the SubSeries listed below. Refer to individual Series

2015-09-16 | E-GEOD-72370 | biostudies-arrayexpress

Promixity labling and Affinity purification of TRIAD3A interactome

Project description:To identify cargo content involved in TRIAD3A-mediated selective autophagy, we expressed TRIAD3A fused to an engineered biotin ligase (TurboID) by viral transduction in mouse brain excitatory neurons (AAV-CAMKII-TRIAD3A-V5-TurboID). After treatment with biotin substrate, brain was harvested and biotinylated proteins were identified by liquid chromatography-tandem mass spectrometry

2024-06-14 | PXD053114 | Pride

Multiple Arkadia/RNF111 structures coordinate its Polycomb body association and transcriptional control

Project description:The RING domain protein Arkadia/RNF111 is a ubiquitin ligase in the transforming growth factor beta (TGFβ) pathway. We previously identified Arkadia as a small ubiquitin-like modifier (SUMO)-binding protein with clustered SUMO-interacting motifs (SIMs) that together form a SUMO-binding domain (SBD). However, precisely how SUMO interaction contributes to the function of Arkadia was not resolved. Through analytical molecular and cell biology, we found that the SIMs share redundant function with Arkadia's M domain, a region distinguishing Arkadia from its paralogs ARKL1/ARKL2 and the prototypical SUMO-targeted ubiquitin ligase (STUbL) RNF4. The SIMs and M domain together promote both Arkadia's colocalization with CBX4/Pc2, a component of Polycomb bodies, and the activation of a TGFbeta pathway transcription reporter. Transcriptome profiling through RNA sequencing showed that Arkadia can both promote and inhibit gene expression, indicating that Arkadia's activity in transcriptional control may depend on the epigenetic context, defined by Polycomb repressive complexes and DNA methylation [Sun, Liu, and Hunter (2014) Mol Cell Biol 34(16):2981-2995]. To determine the role of Arkadia in TGFβ signaling at the transcriptome level, the profiles of TGFβ-stimulated gene expression were examined in Ark+/+ (Ark_WT), Ark-/- (Ark_null), and Arkadia (WT and sim mutant)-reconstituted Ark-/- MEFs. RNA sequencing was carried out using poly(A)-enriched RNA samples from unstimulated cells and cells treated with TGFβ for 1h, 4h, or 16h as indicated. Two batches of sequencing data for a total of 16 independent samples were submitted.

2015-02-11 | E-GEOD-65796 | biostudies-arrayexpress

Analysis of protein expression in the lung of mice infected with influenza virus(WSN)

Project description:In order to analysis the changes of protein expression and its influence on innate immune in mice lung after influenza virus infection,we detect protein expression profile by iTRAQ method

2020-07-06 | PXD017061 | Pride

Angiopoietin-like 4 Increases Pulmonary Vascular Leakiness and Lung Tissue Damage during Influenza Pneumonia

Project description:cANGPTL4 has been shown by our experiments to be associated to influenza-induced pneumonia pathogenesis. cANGPTL4 was produced in abundance during infection and inflammation and showed involvment in regulating blood vessel permeability. By using anti-cANGPTL4 monoclonal antibody, we want to see the overall effect of this antibody treatment, to evaluate the potential of anti-cANGPTL4 antibody as a possible treatment method for pneumonia, and also to gain more insight into the role of cANGPTL4 in infection and inflammation. We used microarrays to detail the global impact of anti-cANGPTL4 antibody treatment to see the possible mechanism pathways involved, as well as to identify the possible side effects caused by anti-cANGPTL4 antibody treatment to evaluate its potential as a treatment method. Mouse lungs were harvested at different timepoints before and after antibody injection to see the changes caused by antibody injection as well as the overall trend during disease progression. To this end, we infected the mice and injected antibodies starting from day 13 post infection. We did the first harvest of lungs at day 12, before the antibody injection was started, to get a starting status to reflect the effect of antibody treatment. Samples harvested at day 14 post infection was analyzed to see the effect caused by antibody injection after 24 hours, and samples harvested at day 18 post infection was analyzed as the end point because our previous experiments showed significantly improved recovery at day 18 after antibody treatment.

2015-06-20 | E-GEOD-58647 | biostudies-arrayexpress

Transcription profiling by array of influenza PR8 infected mouse lung tissue

Project description:C57BL/6J (WT) mice were infected with influenza A virus PR/8/34 or mock infected with phosphate buffered saline (PBS). 18 hours later lung tissue was harvested for transcriptional profiling.

2014-11-23 | E-MTAB-2845 | biostudies-arrayexpress

Ankrd2 silencing

Project description:CHQ5B primary human myoblasts obtained from Dr V. Mouly (Paris, France) have been described previously (Faulkner et al., 1999). Ankrd2 is upregulated on differentiation of myoblasts. The change in gene expression was studied in cells silenced for Ankrd2 (infected with AAV-shAnkrd2), control cells (infected with AAV-shLuc) and control cells uninfected.

2011-12-31 | E-MEXP-2949 | biostudies-arrayexpress

OmicsDI is part of the ELIXIR infrastructure

OmicsDI is an Elixir interoperability service. Learn more ›

Tweets

OmicsDI Databases

PRIDE
PeptideAtlas
MassIVE
JPOST Repository
Physiome Model Repository

EGA
EVA
ENA
LINCS
PAXDB
Cell Collective

MetaboLights
Metabolomics Workbench
MetabolomeExpress
GNPS
BioModels
FAIRDOMHub

ArrayExpress
dbGaP
ExpressionAtlas
GEO
NODE

Information

Databases
Help
API
Contact us
Code on GitHub
Terms of use
Submit Data