Exploration of small RNAs.
Ontology highlight
ABSTRACT:
SUBMITTER: Kawaji H
PROVIDER: S-EPMC2213711 | biostudies-literature | 2008 Jan
REPOSITORIES: biostudies-literature
Publications
For several decades, only a limited number of noncoding RNAs, such as ribosomal and transfer RNA, have been studied in any depth. In recent years, additional species of noncoding RNAs have increasingly been discovered. Of these, small RNA species attract particular interest because of their essential roles in processes such as RNA silencing and modifications. Detailed analyses revealed several pathways associated with the function of small RNAs. Although these pathways show evolutional conservat ...[more]
Similar Datasets
Project description:Background: Improved healthcare and recent breakthroughs in technology have substantially reduced cancer mortality rates worldwide. Recent advancements in next-generation sequencing (NGS) have allowed genomic analysis of the human transcriptome. Now, using NGS we can further look into small non-coding regions of RNAs (sncRNAs) such as microRNAs (miRNAs), Piwi-interacting-RNAs (piRNAs), long non-coding RNAs (lncRNAs), and small nuclear/nucleolar RNAs (sn/snoRNAs) among others. Recent studies looking at sncRNAs indicate their role in important biological processes such as cancer progression and predict their role as biomarkers for disease diagnosis, prognosis, and therapy. Results: In the present study, we data mined publically available small RNA sequencing data from colorectal tissue samples of eight matched patients (benign, tumor, and metastasis) and remapped the data for various small RNA annotations. We identified aberrant expression of 13 miRNAs in tumor and metastasis specimens [tumor vs benign group (19 miRNAs) and metastasis vs benign group (38 miRNAs)] of which five were upregulated, and eight were downregulated, during disease progression. Pathway analysis of aberrantly expressed miRNAs showed that the majority of miRNAs involved in colon cancer were also involved in other cancers. Analysis of piRNAs revealed six to be over-expressed in the tumor vs benign cohort and 24 in the metastasis vs benign group. Only two piRNAs were shared between the two cohorts. Examining other types of small RNAs [sn/snoRNAs, mt_rRNA, miscRNA, nonsense mediated decay (NMD), and rRNAs] identified 15 sncRNAs in the tumor vs benign group and 104 in the metastasis vs benign group, with only four others being commonly expressed. Conclusion: In summary, our comprehensive analysis on publicly available small RNA-seq data identified multiple differentially expressed sncRNAs during colorectal cancer progression at different stages compared to normal colon tissue. We speculate that deciphering and validating the roles of sncRNAs may prove useful in colorectal cancer prognosis, diagnosis, and therapy.
| S-EPMC5362762 | biostudies-literature
Project description:The small RNAs presented here were produced as a preliminary exploration of small RNAs in rice, and as such, various tissues and stress conditions were sampled. Small RNAs present in these samples were all mapped to the rice genome TIGR version 5. The total number of distinct mapped sequences are 12879 for Run 1 and 88508 for Run 2. The total number of sequence reads were respectively 70406 and 191682. The datasets contain Oryza sativa var Nipponbar endogenous small RNA sequences in the size range 18 to 34 nt. Plants were grown in a Conviron Environmental Chamber at high light intensity using both high pressure sodium and metal halide lamps for 10.5 hr at 28 degrees C and for 13.5 hr at 26 degrees C in the dark. RNA was extracted from rice tissues at various stages of development and under different abiotic and biotic stresses. The small RNAs presented here were all mapped to the rice genome TIGR version 5. The total number of distinct mapped sequences are 12879 for Run 1 and 88508 for Run 2. The total number of sequence reads were respectively 70406 and 191682. Run 1: A small RNA library was generated from whole cell RNA isolated from inflorescence, 30 and 60 day leaves, 10 and 25 day seedlings and from seedling polysomes using Bartel primers (5' ATCGTAGGCACCTGAAA - smRNA - CTGTAGGCACCATCAAT 3'). This was combined with a library derived from whole cell RNA isolated from 30 and 60 day leaves and 10 and 25 day seedlings using Bartel A primers (5' AGCTATCGTAGGCACCTGAAA - smRNA - CTGTAGGCACCATCAATACTG 3'). Run 2: Mixed tissues from unstressed plants. Library prepared from equal amounts of adult root, adult stem and inflorescence from unstressed plants. Amplified with Standard primers (5' ATCGTAGGCACCTGAAA - smRNA - CTGTAGGCACCATCAAT 3'). Seedlings stressed by cold, salt desiccation, heat and dark. Tissues were mixed in a 2:2:1:1:1:1 ratio. Amplified with A primers (5' AGCTATCGTAGGCACCTGAAA - smRNA - CTGTAGGCACCATCAATACTG 3'). Kinase library. RNA was isolated from tissues used in 'Adult whole plant' (~30%), 'Stressed' (~25%), from unstressed seedlings of various ages (~15%) from 30 and 60 day leaves (20%) and from immature inflorescence (~10%). RNA isolated from tissues from unstressed plants were treated with polynucleotide kinase before second ligation. This eliminates the dependence of a 5` phosphate as for all the other libraries. Amplified with B primers (5' CAGTATCGTAGGCACCTGAAA - smRNA - CTGTAGGCACCATCAATAGCT 3').
2009-06-07 | E-GEOD-16248 | biostudies-arrayexpress
Project description:The small RNAs presented here were produced as a preliminary exploration of small RNAs in rice, and as such, various tissues and stress conditions were sampled. Small RNAs present in these samples were all mapped to the rice genome TIGR version 5. The total number of distinct mapped sequences are 12879 for Run 1 and 88508 for Run 2. The total number of sequence reads were respectively 70406 and 191682. The datasets contain Oryza sativa var Nipponbar endogenous small RNA sequences in the size range 18 to 34 nt. Plants were grown in a Conviron Environmental Chamber at high light intensity using both high pressure sodium and metal halide lamps for 10.5 hr at 28 degrees C and for 13.5 hr at 26 degrees C in the dark. RNA was extracted from rice tissues at various stages of development and under different abiotic and biotic stresses. The small RNAs presented here were all mapped to the rice genome TIGR version 5. The total number of distinct mapped sequences are 12879 for Run 1 and 88508 for Run 2. The total number of sequence reads were respectively 70406 and 191682.
2009-06-08 | GSE16248 | GEO
Project description:When a novel nutritional concept comes along, scientists become enthusiastic and start new explorations. In 2012, the field was enthralled with a study suggesting plant-based nucleic acid "information" acts as a bioactive to regulate animal metabolism.
| S-EPMC5501344 | biostudies-other
Project description:RNA in milk exosomes can be absorbed in the mammalian intestinal tract and function in gene expression regulations. Our previous work demonstrated that porcine milk exosomes (PME) contain large amounts of miRNAs and mRNAs. Increasing evidence suggests that long non-coding RNAs (lncRNAs) and circular RNAs (circRNAs) are of particular interest, given their key role in diverse biological processes of animals. However, the expression profiles and the potential functions of lncRNAs and circRNAs in PME are still unknown. In the present study, we isolated PME by ultracentrifugation and performed a comprehensive analysis of lncRNA and circRNA in PME by using RNA sequencing. As a result, 2,466 novel lncRNAs, 809 annotated lncRNAs, and 61 circRNAs were identified in PME. The lncRNAs shared similar characteristics with other mammals in terms of length, exon number, and open reading frames. However, lncRNAs showed a higher level compared with mRNAs. Eight lncRNAs and five circRNAs in PME were selected for PCR identification. A functional enrichment analysis on the target genes of lncRNAs indicated that these genes were involved in cellular macromolecule metabolic, RNA metabolic, and immune processes. The circRNAs host genes were enriched in nucleic acid binding and adherence junction. We also evaluated the potential interaction targets between miRNAs and PME lncRNAs or circRNAs, and the results showed that the PME lncRNAs and the circRNAs have a high density of miRNA target sites. The top 20 highly expressed lncRNAs were found to interact with the proliferation-related miRNAs, and the circRNAs potentially targeted many miRNAs that are associated with the intestinal barrier. This study is the first to provide a resource for lncRNA and circRNA research of porcine milk. Moreover, the potential interaction between lncRNA/circRNA and miRNA is revealed. The present study expands our knowledge of non-coding RNAs in milk, and additional research is necessary to confirm their exactly physiological functions.
| S-EPMC7343709 | biostudies-literature
Project description:Genome-wide association studies (GWAS) have proven a fundamental tool to identify common variants associated to complex traits, thus contributing to unveil the genetic components of human disease. Besides, the advent of GWAS contributed to expose unexpected findings that urged to redefine the framework of population genetics. First, loci identified by GWAS had small effect sizes and could only explain a fraction of the predicted heritability of the traits under study. Second, the majority of GWAS hits mapped within non-coding regions (such as intergenic or intronic regions) where new functional RNA species (such as lncRNAs or circRNAs) have started to emerge. Bigger cohorts, meta-analysis and technical improvements in genotyping allowed identification of an increased number of genetic variants associated to coronary artery disease (CAD) and cardiometabolic traits. The challenge remains to infer causal mechanisms by which these variants influence cardiovascular disease development. A tendency to assign potential causal variants preferentially to coding genes close to lead variants contributed to disregard the role of non-coding elements. In recent years, in parallel to an increased knowledge of the non-coding genome, new studies started to characterize disease-associated variants located within non-coding RNA regions. The upcoming of databases integrating single-nucleotide polymorphisms (SNPs) and non-coding RNAs together with novel technologies will hopefully facilitate the discovery of causal non-coding variants associated to disease. This review attempts to summarize the current knowledge of genetic variation within non-coding regions with a focus on long non-coding RNAs that have widespread impact in cardiometabolic diseases.
| S-EPMC6304420 | biostudies-literature
Project description:The past two decades have seen extensive research done to pinpoint the role of microRNAs (miRNAs) that have led to discovering thousands of miRNAs in humans. It is not, therefore, surprising to see many of them implicated in a number of common as well as rare human diseases. In this review article, we summarize the progress in our understanding of miRNA-related research in conjunction with different types of cancers and neurodegenerative diseases, as well as their potential in generating more reliable diagnostic and therapeutic approaches.
| S-EPMC7460979 | biostudies-literature
Project description:tRNA‑derived small RNAs (tsRNAs) have been shown to play regulatory roles in many physiological and pathological processes. However, their roles in hypertrophic scars remain unclear. The present study investigated differentially expressed tsRNAs in human hypertrophic scar fibroblasts and normal skin fibroblasts via high‑throughput sequencing. Several dysregulated tsRNAs were validated by reverse transcription‑quantitative polymerase chain reaction (RT‑qPCR). Gene Ontology (GO) and Kyoto Encyclopedia of Genes and Genomes (KEGG) pathway enrichment, target prediction, coexpression networks and competing endogenous RNA (ceRNA) networks were evaluated to discover the principal functions of significantly differentially expressed tsRNAs. In total, 67 differentially expressed tsRNAs were detected, of which 27 were upregulated and 40 downregulated in hypertrophic scar fibroblasts. The GO analysis indicated that the dysregulated tsRNAs are associated with numerous biological functions, including 'nervous system development', 'cell adhesion', 'focal adhesion', 'protein binding', 'angiogenesis' and 'actin binding'. KEGG pathway analysis revealed that the most altered pathways include 'Ras signaling pathway', 'Rap1 signaling pathway' and 'cGMP‑PKG signaling pathway'. The target genes of the differentially expressed tsRNAs participate in several signaling pathways important for scar formation. The results of RT‑qPCR were consistent with those of sequencing. MicroRNA (miR)‑29b‑1‑5p was identified as a target of tsRNA‑23678 and was downregulated in hypertrophic scar fibroblasts, constituting a negative regulatory factor for scar formation. Furthermore, tsRNA‑23761 acted as a ceRNA and bound to miR‑3135b to regulate the expression of miR‑3135b targets, including angiotensin‑converting enzyme. Collectively, these findings reveal that tsRNAs are differentially expressed in human hypertrophic scar fibroblasts, and may contribute to the molecular mechanism and treatment of hypertrophic scars.
| S-EPMC6889923 | biostudies-literature
Project description:Small nucleolar RNAs (snoRNAs) guide RNA modification and are localized in nucleoli and Cajal bodies in eukaryotic cells. Components of the RNA silencing pathway associate with these structures, and two recent reports have revealed that a human and a protozoan snoRNA can be processed into miRNA-like RNAs. Here we show that small RNAs with evolutionary conservation of size and position are derived from the vast majority of snoRNA loci in animals (human, mouse, chicken, fruit fly), Arabidopsis, and fission yeast. In animals, sno-derived RNAs (sdRNAs) from H/ACA snoRNAs are predominantly 20-24 nucleotides (nt) in length and originate from the 3' end. Those derived from C/D snoRNAs show a bimodal size distribution at approximately 17-19 nt and >27 nt and predominantly originate from the 5' end. SdRNAs are associated with AGO7 in Arabidopsis and Ago1 in fission yeast with characteristic 5' nucleotide biases and show altered expression patterns in fly loquacious and Dicer-2 and mouse Dicer1 and Dgcr8 mutants. These findings indicate that there is interplay between the RNA silencing and snoRNA-mediated RNA processing systems, and that sdRNAs comprise a novel and ancient class of small RNAs in eukaryotes.
| S-EPMC2704076 | biostudies-literature
Project description:PIWI-interacting RNAs (piRNAs) are small noncoding RNAs that bind PIWI family proteins exclusively expressed in the germ cells of mammalian gonads. MIWI2-associated piRNAs are essential for silencing transposons during primordial germ cell development, and MIWI-bound piRNAs are required for normal spermatogenesis during adulthood in mice. Although piRNAs have long been regarded as germ cell-specific, increasing lines of evidence suggest that somatic cells also express piRNA-like RNAs (pilRNAs). Here, we report the detection of abundant pilRNAs in somatic cells, which are similar to MIWI-associated piRNAs mainly expressed in pachytene spermatocytes and round spermatids in the testis. Based on small RNA deep sequencing and quantitative PCR analyses, pilRNA expression is dynamic and displays tissue specificity. Although pilRNAs are similar to pachytene piRNAs in both size and genomic origins, they have a distinct ping-pong signature. Furthermore, pilRNA biogenesis appears to utilize a yet to be identified pathway, which is different from all currently known small RNA biogenetic pathways. In addition, pilRNAs appear to preferentially target the 3'-UTRs of mRNAs in a partially complementary manner. Our data suggest that pilRNAs, as an integral component of the small RNA transcriptome in somatic cell lineages, represent a distinct population of small RNAs that may have functions similar to germ cell piRNAs.
| S-EPMC4239631 | biostudies-literature