Dataset Information

Development of patatin knockdown potato tubers using RNA interference (RNAi) technology, for the production of human-therapeutic glycoproteins.

ABSTRACT: BACKGROUND: Patatins encoded by a multi-gene family are one of the major storage glycoproteins in potato tubers. Potato tubers have recently emerged as bioreactors for the production of human therapeutic glycoproteins (vaccines). Increasing the yield of recombinant proteins, targeting the produced proteins to specific cellular compartments, and diminishing expensive protein purification steps are important research goals in plant biotechnology. In the present study, potato patatins were eliminated almost completely via RNA interference (RNAi) technology to develop potato tubers as a more efficient protein expression system. The gene silencing effect of patatins in the transgenic potato plants was examined at individual isoform levels. RESULTS: Based upon the sequence similarity within the multi-gene family of patatins, a highly conserved target sequence (635 nts) of patatin gene pat3-k1 [GenBank accession no. DQ114421] in potato plants (Solanum tuberosum L.) was amplified for the construction of a patatin-specific hairpin RNAi (hpRNAi) vector. The CaMV 35S promoter-driven patatin hpRNAi vector was transformed into the potato cultivar Desiree by Agrobacterium-mediated transformation. Ten transgenic potato lines bearing patatin hpRNA were generated. The effects of RNA interference were characterized at both the protein and mRNA levels using 1D and 2D SDS/PAGE and quantitative real-time RT-PCR analysis. Dependent upon the patatin hpRNAi line, patatins decreased by approximately 99% at both the protein and mRNA levels. However, the phenotype (e.g. the number and size of potato tuber, average tuber weight, growth pattern, etc.) of hpRNAi lines was not distinguishable from wild-type potato plants under both in vitro and ex vitro growth conditions. During glycoprotein purification, patatin-knockdown potato tubers allowed rapid purification of other potato glycoproteins with less contamination of patatins. CONCLUSION: Patatin-specific hpRNAi effectively suppressed the expression of a majority of patatin variants in potato tubers via the specific degradation of individual mRNAs of the patatin multi-gene family. More importantly, patatin-knockdown potato tubers appear to be an ideal host for the production of human therapeutic glycoproteins, because they eventually allow fast, easy purification of recombinant proteins, with less contamination from potato glycoprotein patatins.

SUBMITTER: Kim YS

PROVIDER: S-EPMC2335101 | biostudies-literature | 2008

REPOSITORIES: biostudies-literature

ACCESS DATA

Publications

Development of patatin knockdown potato tubers using RNA interference (RNAi) technology, for the production of human-therapeutic glycoproteins.

Kim Yoon-Sik YS Lee Yong-Hwa YH Kim Hyun-Soon HS Kim Mi-Sun MS Hahn Kyu-Woong KW Ko Jeong-Heon JH Joung Hyouk H Jeon Jae-Heung JH

BMC biotechnology 20080403

<h4>Background</h4>Patatins encoded by a multi-gene family are one of the major storage glycoproteins in potato tubers. Potato tubers have recently emerged as bioreactors for the production of human therapeutic glycoproteins (vaccines). Increasing the yield of recombinant proteins, targeting the produced proteins to specific cellular compartments, and diminishing expensive protein purification steps are important research goals in plant biotechnology. In the present study, potato patatins were e ...[more]

PMID: 18384693

Similar Datasets

Project description:Since prion gene-knockout mice do not contract prion diseases and animals in which production of prion protein (PrP) is reduced by half are resistant to the disease, we hypothesized that bovine animals with reduced PrP would be tolerant to BSE. Hence, attempts were made to produce bovine PRNP (bPRNP) that could be knocked down by RNA interference (RNAi) technology. Before an in vivo study, optimal conditions for knocking down bPRNP were determined in cultured mammalian cell systems. Factors examined included siRNA (short interfering RNA) expression plasmid vectors, target sites of PRNP, and lengths of siRNAs.Four siRNA expression plasmid vectors were used: three harboring different cloning sites were driven by the human U6 promoter (hU6), and one by the human tRNAVal promoter. Six target sites of bovine PRNP were designed using an algorithm. From 1 (22 mer) to 9 (19, 20, 21, 22, 23, 24, 25, 27, and 29 mer) siRNA expression vectors were constructed for each target site. As targets of siRNA, the entire bPRNP coding sequence was connected to the reporter gene of the fluorescent EGFP, or of firefly luciferase or Renilla luciferase. Target plasmid DNA was co-transfected with siRNA expression vector DNA into HeLaS3 cells, and fluorescence or luminescence was measured. The activities of siRNAs varied widely depending on the target sites, length of the siRNAs, and vectors used. Longer siRNAs were less effective, and 19 mer or 21 mer was generally optimal. Although 21 mer GGGGAGAACTTCACCGAAACT expressed by a hU6-driven plasmid with a Bsp MI cloning site was best under the present experimental conditions, the corresponding tRNA promoter-driven plasmid was almost equally useful. The effectiveness of this siRNA was confirmed by immunostaining and Western blotting.Four siRNA expression plasmid vectors, six target sites of bPRNP, and various lengths of siRNAs from 19 mer to 29 mer were examined to establish optimal conditions for knocking down of bPRNP in vitro. The most effective siRNA so far tested was 21 mer GGGGAGAACTTCACCGAAACT driven either by a hU6 or tRNA promoter, a finding that provides a basis for further studies in vivo.

Project description:This is a study to characterize gene expression profiles in stored Russet Burbank potato tubers. Tubers were harvested from commercial fields in the central sands region of Wisconsin in the fall of 2006. The tubers were put into storage at 55 degrees F for preconditioning and wound healing. Shortly after the temperature of the storage bin began to decrease, uniform, healthy tubers were selected for use in this microarray analysis. Tubers were at 53.6 degrees F at this time, and pieces of starch-storing tissue were collected for use as the reference sample. Other tubers were moved to temperature-controlled lockers and these were cooled gradually to either 48 or 40 degrees F following industry standard procedures. The expectation was that tubers held at 48 degrees would not have a significant accumulation of glucose and fructose, but that tubers cooled to 40 degrees would undergo low temperature sweetening and accumulate glucose and fructose to a degree that is unsuitable for processing. Three weeks later, when the locker temperatures were 48 degrees F and 41.5 degrees F, tissue samples were collected for RNA analysis. After another three weeks, samples were collected from tubers at 48 degrees F and 40 degrees F. At that time some tubers were moved from the 48 degree locker to the 40 degree locker in order to see if gene expression changes observed as a result of gradual cooling are similar to those that occur following a sudden decrease in temperature. Three weeks later, samples were collected from tubers held at 48 degrees F, tubers held at 40 degrees F, and from the tubers that were moved from 48 to 40 degrees F. At this time another set of tubers was transferred from 48 degrees to 40 degrees. Three weeks later the last samples were harvested from tubers held at 48 degrees F, from tubers held at 48 degrees F and from tubers that were transferred three weeks prior from 48 to 40 degrees. RNA was isolated from tissue extracted from three tubers. Keywords: Reference design

Project description:Background and aimsThe three-dimensional distributions of mineral elements in potato tubers provide insight into their mechanisms of transport and deposition. Many of these minerals are essential to a healthy human diet, and characterizing their distribution within the potato tuber will guide the effective utilization of this staple foodstuff.MethodsThe variation in mineral composition within the tuber was determined in three dimensions, after determining the orientation of the harvested tuber in the soil. The freeze-dried tuber samples were analysed for minerals using inductively coupled plasma-mass spectrometry (ICP-MS). Minerals measured included those of nutritional significance to the plant and to human consumers, such as iron, zinc, copper, calcium, magnesium, manganese, phosphorus, potassium and sulphur.Key resultsThe concentrations of most minerals were higher in the skin than in the flesh of tubers. The potato skin contained about 17 % of total tuber zinc, 34 % of calcium and 55 % of iron. On a fresh weight basis, most minerals were higher in tuber flesh at the stem end than the bud end of the tuber. Potassium, however, displayed a gradient in the opposite direction. The concentrations of phosphorus, copper and calcium decreased from the periphery towards the centre of the tuber.ConclusionsThe distribution of minerals varies greatly within the potato tuber. Low concentrations of some minerals relative to those in leaves may be due to their low mobility in phloem, whereas high concentrations in the skin may reflect direct uptake from the soil across the periderm. In tuber flesh, different minerals show distinct patterns of distribution in the tuber, several being consistent with phloem unloading in the tuber and limited onward movement. These findings have implications both for understanding directed transport of minerals in plants to stem-derived storage organs and for the dietary implications of different food preparation methods for potato tubers.

Dataset Information

Development of patatin knockdown potato tubers using RNA interference (RNAi) technology, for the production of human-therapeutic glycoproteins.

Publications

Development of patatin knockdown potato tubers using RNA interference (RNAi) technology, for the production of human-therapeutic glycoproteins.

Similar Datasets

OmicsDI is part of the ELIXIR infrastructure

Tweets