2'-5'-Oligoadenylate synthetase single-nucleotide polymorphisms and haplotypes are associated with variations in immune responses to rubella vaccine.
Ontology highlight
ABSTRACT:
SUBMITTER: Haralambieva IH
PROVIDER: S-EPMC2842477 | biostudies-literature |
REPOSITORIES: biostudies-literature
Similar Datasets
Project description:The observed heterogeneity in rubella-specific immune response phenotypes post-MMR vaccination is thought to be explained, in part, by inter-individual genetic variation. In this study, single nucleotide polymorphisms (SNPs) and multiple haplotypes in several candidate genes were analyzed for associations with more than one rubella-specific immune response outcome, including secreted IFN-γ, secreted IL-6, and neutralizing antibody titers. Overall, we identified 23 SNPs in 10 different genes that were significantly associated with at least two rubella-specific immune responses. Of these SNPs, we detected eight in the PVRL3 gene, five in the PVRL1 gene, one in the TRIM22 gene, two in the IL10RB gene, two in the TLR4 gene, and five in other genes (PVR, ADAR, ZFP57, MX1, and BTN2A1/BTN3A3). The PVRL3 gene haplotype GACGGGGGCAGCAAAAAGAAGAGGAAAGAACAA was significantly associated with both higher IFN-γ secretion (t-statistic 4.43, p < 0.0001) and higher neutralizing antibody titers (t-statistic 3.14, p = 0.002). Our results suggest that there is evidence of multigenic associations among identified gene SNPs and that polymorphisms in these candidate genes contribute to the overall observed differences between individuals in response to live rubella virus vaccine. These results will aid our understanding of mechanisms behind rubella-specific immune response to MMR vaccine and influence the development of vaccines in the future.
| S-EPMC4587390 | biostudies-literature
Project description:BackgroundOligoadenylate synthetases (OASs) are widely distributed in Metazoa including sponges, fish, reptiles, birds and mammals and show large variation, with one to twelve members in any given species. Upon double-stranded RNA (dsRNA) binding, avian and mammalian OASs generate the second messenger 2'-5'-linked oligoadenylate (2-5A), which activates ribonuclease L (RNaseL) and blocks viral replication. However, how Metazoa shape their OAS repertoires to keep evolutionary balance to virus infection is largely unknown. We performed comprehensive phylogenetic and functional analyses of OAS genes from evolutionarily lower to higher Metazoa to demonstrate how the OAS repertoires have developed anti-viral activity and diversified their functions.ResultsAncient Metazoa harbor OAS genes, but lack both upstream and downstream genes of the OAS-related pathways, indicating that ancient OASs are not interferon-induced genes involved in the innate immune system. Compared to OASs of ancient Metazoa (i.e. sponge), the corresponding ones of higher Metazoa present an increasing number of basic residues on the OAS/dsRNA interaction interface. Such an increase of basic residues might improve their binding affinity to dsRNA. Moreover, mutations of functional residues in the active pocket might lead to the fact that higher Metazoan OASs lose the ability to produce 3'-5'-linked oligoadenylate (3-5A) and turn into specific 2-5A synthetases. In addition, we found that multiple rounds of gene duplication and domain coupling events occurred in the OAS family and mutations at functionally critical sites were observed in most new OAS members.ConclusionsWe propose a model for the expansion of OAS members and provide comprehensive evidence of subsequent neo-functionalization and sub-functionalization. Our observations lay the foundation for interrogating the evolutionary transition of ancient OAS genes to host defense genes and provide important information for exploring the unknown function of the OAS gene family.
| S-EPMC6307210 | biostudies-literature
Project description:Vitamins A and D, and their receptors, are important regulators of the immune system, including vaccine immune response. We assessed the association between polymorphisms in the vitamin A receptors [retinoic acid receptor ?, retinoic acid receptor ? (RARB), and retinoic acid receptor ?] and vitamin D receptor (VDR)/retinoid X receptor ? (RXRA) genes and interindividual variations in immune responses after two doses of measles vaccine in 745 children.Using a tag single nucleotide polymorphism (SNP) approach, we genotyped 745 healthy children for the 391 polymorphisms in vitamin A receptor and VDR genes.The RARB haplotype (rs6800566/rs6550976/rs9834818) was significantly associated with variations in both measles antibody (global, P=0.013) and cytokine secretion levels, such as interleukin (IL)-10 (global, P=0.006), interferon (IFN)-? (global, P=0.008), and tumor necrosis factor-? (global, P=0.039) in the Caucasian subgroup. Specifically, the RARB haplotype, AAC, was associated with higher (t-statistic: 3.27, P=0.001) measles antibody levels. At the other end of the spectrum, haplotype GG for rs6550978/rs6777544 was associated with lower antibody levels (t-statistic: -2.32, P=0.020) in the Caucasian subgroup. In a sensitivity analysis, the RARB haplotype, CTGGGCAA, remained marginally significant (P<0.02) when the single SNP rs12630816 was included in the model for IL-10 secretion levels. A significant association was found between lower measles-specific IFN-? Enzyme-linked immunosorbent spot responses and haplotypes rs11102986/rs11103473/rs11103482/rs10776909/rs12004589/rs35780541/rs2266677/rs875444 (global, P=0.004) and rs6537944/rs3118571 (global, P<0.001) in the RXRA gene for Caucasians. We also found associations between multiple RARB, VDR, and RXRA SNPs/haplotypes and measles-specific IL-2, IL-6, IL-10, IFN-?, IFN-?, IFN?-1, and TNF-? cytokine secretions.Our results suggest that specific allelic variations and haplotypes in the vitamin A receptor and VDR genes may influence adaptive immune responses to measles vaccine.
| S-EPMC3237827 | biostudies-literature
Project description:Single-nucleotide polymorphisms (SNPs) in candidate immune response genes were evaluated for associations with measles- and rubella-specific neutralizing antibodies, interferon (IFN)-γ, and interleukin (IL)-6 secretion in two separate association analyses in a cohort of healthy immunized subjects. We identified six SNP associations shared between the measles-specific and rubella-specific immune responses, specifically neutralizing antibody titers (DDX58), secreted IL-6 (IL10RB, IL12B), and secreted IFN-γ (IFNAR2, TLR4). An intronic SNP (rs669260) in the antiviral innate immune receptor gene, DDX58, was significantly associated with increased neutralizing antibody titers for both measles and rubella viral antigens post-MMR vaccination (p values 0.02 and 0.0002, respectively). Significant associations were also found between IL10RB (rs2284552; measles study p value 0.006, rubella study p value 0.00008) and IL12B (rs2546893; measles study p value 0.005, rubella study p value 0.03) gene polymorphisms and variations in both measles- and rubella virus-specific IL-6 responses. We also identified associations between individual SNPs in the IFNAR2 and TLR4 genes that were associated with IFN-γ secretion for both measles and rubella vaccine-specific immune responses. These results are the first to indicate that there are SNP associations in common across measles and rubella vaccine immune responses and that SNPs from multiple genes involved in innate and adaptive immune response regulation may contribute to the overall human antiviral response.
| S-EPMC4198472 | biostudies-literature
Project description:BACKGROUND:2'-5'-Oligoadenylate synthetase 1 (OAS1) plays an important role in inflammatory immune reactions. OAS1 polymorphisms have been associated with increased susceptibility to various diseases. We investigated the association of polymorphisms in OAS1 with tuberculosis (TB). METHODS:A total of 1215?TB cases and 1114 healthy controls were enrolled from two independent studies. Genotyping was conducted using the improved multiplex ligase detection reaction (iMLDR) method. Associations between OAS1 polymorphisms (rs2240190, rs1131454, 10,774,671 and 11,066,453) and TB risk were established based on distributions of allelic frequencies using different genetic models. RESULTS:Significant association was observed between rs10774671, rs1131454 and TB. In the initial study, the G allele of rs10774671 was a significantly protective factor against TB (P?=?0.006) and the genotype of GG differed significantly between TB patients and controls under the codominant model (P?=?0.008) after Bonferroni correction. In the validation study, we also observed that the rs10774671 G allele (P?=?0.001) and GG genotype (P?=?0.001) were associated with TB. In addition, we found that the rs1131454 G allele (P?=?0.004) and GG genotype (P?=?0.001) were protective against TB in the Chinese Han population. CONCLUSIONS:We report novel associations of polymorphisms in OAS1 with TB in the Chinese Tibetan and Han populations. Similar studies in different populations and functional studies are warranted to confirm our results.
| S-EPMC6267069 | biostudies-literature
Project description:We analyzed the relationship between host gene polymorphisms and responses in recipients of inactivated influenza vaccine, who were classified into poor, normal, or adverse response groups. The frequency of the mannose-binding lectin-2 codon 54 allele was significantly different among the 3 types of responders, with a decreased odds ratio for the development of poor or adverse responses (P=.033). There was no statistical relationship between responses and either tumor necrosis factor- alpha or interleukin (IL)-10 promoter polymorphisms among the 3 response groups. When poor and normal responses were combined, the -1082 A allele in the IL-10 promoter conferred a significantly decreased risk of the development of adverse responses (P=.041). These data indicate that host polymorphisms play a role in determining responses to influenza vaccine.
| S-EPMC7111848 | biostudies-literature
Project description:Genetic polymorphisms are known to affect responses to both viral infection and vaccination. Our previous work has described genetic polymorphisms significantly associated with variations in immune response to rubella vaccine from multiple gene families with known immune function, including HLA, cytokine and cytokine receptor genes, and in genes controlling innate and adaptive immunity. In this study, we assessed cellular immune responses (IFN? and IL-6) in a cohort of healthy younger individuals and performed genome-wide SNP analysis on these same individuals. Here, we report the first genome-wide association study focused on immune responses following rubella vaccination. Our results indicate that rs16928280 in protein tyrosine phosphatase delta (PTPRD) and a collection of SNPs in ACO1 (encoding an iron regulatory protein) are associated with interindividual variations in IFN? response to rubella virus stimulation. In contrast, we did not identify any significant genetic associations with rubella-specific IL-6 response. These genetic regions may influence rubella vaccine-induced IFN? responses and warrant further studies in additional cohorts in order to confirm these findings.
| S-EPMC4096048 | biostudies-literature
Project description:Recent population-based studies have demonstrated the genetic heritability of rubella vaccine response and assessed that the HLA system may explain about 20% of the inter-individual variance in humoral immune response to this vaccine. Our earlier studies compared HLA allelic associations with rubella vaccine-specific antibodies between two smaller cohorts of healthy Rochester, MN, children (346 and 396 subjects) after two doses of rubella-containing vaccine. This study found that specific HLA alleles were consistently associated with rubella-specific antibody titers (B*27:05, DPA1*02:01, and DPB1*04:01 alleles). The current study examined HLA associations in an independent larger cohort of 1012 healthy San Diego, CA, subjects (age 19-40 years) after rubella vaccine in order to replicate our previous findings in the Rochester subjects. Two HLA associations of comparable magnitudes were consistently observed between B*27:05 (median NT50 Rochester cohort 48.9, p=0.067; San Diego cohort 54.8, p=0.047) and DPB1*04:01 (median NT50 Rochester cohort 61.6, p<0.001; San Diego cohort 70.8, p=0.084) alleles and rubella virus-neutralizing antibody titers. Additional HLA alleles resulted in consistent effects on IL-6 production in both cohorts, but did not meet criteria for statistical significance. Our data suggest these HLA alleles play a role in rubella vaccine-induced immunity and provide the basis for future studies that may explain the mechanism(s) by which these HLA polymorphisms affect immune responses to rubella vaccine.
| S-EPMC4124933 | biostudies-literature
Project description:In the U.S., measles, mumps, and rubella vaccination is recommended as two vaccine doses. A third dose of measles-mumps-rubella (MMR) vaccine is being administered in certain situations (e.g., identified seronegativity and during outbreaks). We studied rubella-specific humoral immunity (neutralizing antibody, enzyme-linked immunosorbent assay/ELISA IgG titer and antibody avidity) and the frequencies of antigen-specific memory B cells before and after a third dose of MMR-II in 109 female participants of childbearing age (median age, 34.5 years old) from Olmsted County, MN, with two documented prior MMR vaccine doses. The participants were selected from a cohort of 1117 individuals if they represented the high and the low ends of the rubella-specific antibody response spectrum. Of the 109 participants, we identified four individuals (3.67% of all study participants; 7.14% of the low-responder group) that were seronegative at Baseline (rubella-specific ELISA IgG titers <10 IU/mL), suggesting a lack of protection against rubella before receipt of a third MMR vaccine dose. The peak geometric mean neutralizing antibody titer one month following the third dose of MMR vaccine for the cohort was 243 NT50 (CI; 241, 245), which is expected for a cohort with two doses of MMR, and the peak geometric mean IgG titer was 150 IU/mL (CI; 148, 152) with no seronegative individuals at Day 28. One-third of all subjects (31.8% for the neutralizing antibody; 30.8% for the IgG titer) experienced a significant boost (≥4-fold) of antibody titers one month following vaccination. Antibody titers and other tested immune-response variables were significantly higher in the high-responder group compared to the low-responder group. The frequencies of rubella-specific memory B cells were modestly associated with the antibody titers. Our study suggests the importance of yet unknown inherent biologic and immune factors for the generation and maintenance of rubella-vaccine-induced humoral immune responses.
| S-EPMC6992489 | biostudies-literature
Project description:Recent studies have suggested the importance of HLA genes in determining immune responses following rubella vaccine. The telomeric class III region of the HLA complex harbors several genes, including lymphotoxin alpha (LTA), tumor necrosis factor (TNF) and leukocyte specific transcript -1 (LST1) genes, located between the class I B and class II DRB1 loci. Apart from HLA, little is known about the effect of this extended genetic region on HLA haplotypic backgrounds as applied to immune responses.We examined the association between immune responses and extended class I-class II-class III haplotypes among 714 healthy children after two doses of rubella vaccination. These extended haplotypes were then compared to the HLA-only haplotypes. The most significant association was observed between haplotypes extending across the HLA class I region, ten-SNP haplotypes, and the HLA class II region (i.e. A-C-B-LTA-TNF-LST1-DRB1-DQA1-DQB1-DPA1-DPB1) and rubella-specific antibodies (global p-value of 0.03). Associations were found between both extended A*02-C*03-B*15-AAAACGGGGC-DRB1*04-DQA1*03-DQB1*03-DPA1*01-DPB1*04 (p = 0.002) and HLA-only A*02-C*03-B*15-DRB1*04-DQA1*03-DQB1*03-DPA1*01-DPB1*04 haplotypes (p = 0.009) and higher levels of rubella antibodies. The class II HLA-only haplotype DRB1*13-DQA1*01-DQB1*06-DPA1*01-DPB1*04 (p = 0.04) lacking LTA-TNF-LST1 SNPs was associated with lower rubella antibody responses. Similarly, the class I-class II HLA-only A*01-C*07-B*08-DRB1*03-DQA1*05-DQB1*02-DPA1*01-DPB1*04 haplotype was associated with increased TNF-alpha secretion levels (p = 0.009). In contrast, the extended AAAACGGGGC-DRB1*01-DQA1*01-DQB1*05-DPA1*01-DPB1*04 (p = 0.01) haplotype was found to trend with decreased rubella-specific IL-6 secretion levels.These data suggest the importance of examining both HLA genes and genes in the class III region as part of the extended haplotypes useful in understanding genomic drivers regulating immune responses to rubella vaccine.
| S-EPMC2910726 | biostudies-literature