Field Deployable Method for Gold Detection Using Gold Pre-Concentration on Functionalized Surfaces.
Ontology highlight
ABSTRACT:
SUBMITTER: Zuber A
PROVIDER: S-EPMC7014198 | biostudies-literature | 2020 Jan
REPOSITORIES: biostudies-literature
Publications
Field Deployable Method for Gold Detection Using Gold Pre-Concentration on Functionalized Surfaces.
Zuber Agnieszka A Bachhuka Akash A Tassios Steven S Tiddy Caroline C Vasilev Krasimir K Ebendorff-Heidepriem Heike H
Sensors (Basel, Switzerland) 20200115 2
<b>Keywords:</b> surface chemistry, plasma polymerization, salinization, gold sensing. ...[more]
Similar Datasets
Project description:Early detection of pediatric viruses is critical to effective intervention. A successful clinical tool must have a low detection limit, be simple to use and report results quickly. No current method meets all three of these criteria. In this report, we describe an approach that combines simple, rapid processing and label free detection. The method detects viral RNA using DNA hairpin structures covalently attached to a gold filament. In this design, the gold filament serves both to simplify processing and enable fluorescence detection. The approach was evaluated by assaying for the presence of respiratory syncytial virus (RSV) using the DNA hairpin probe 5' [C6Thiol]TTTTTTTTTTCGACGAAAAATGGGGCAAATACGTCG[CAL] 3' covalently attached to a 5 cm length of a 100 microm diameter gold-clad filament. This sequence was designed to target a portion of the gene end-intergenic gene start signals which is repeated multiple times within the negative-sense genome giving multiple targets for each strand of genomic viral RNA present. The filament functionalized with probes was immersed in a 200 microm capillary tube containing viral RNA, moved to subsequent capillary tubes for rinsing and then scanned for fluorescence. The response curve had a typical sigmoidal shape and plateaued at about 300 plaque forming units (PFU) of viral RNA in 20 microL. The lower limit of detection was determined to be 11.9 PFU. This lower limit of detection was approximately 200 times better than a standard comparison ELISA. The simplicity of the core assay makes this approach attractive for further development as a viral detection platform in a clinical setting.
| S-EPMC2867084 | biostudies-literature
Project description:For some Cas nucleases, trans-cleavage activity triggered by CRISPR/Cas-mediated cis-cleavage upon target nucleic acid recognition has been explored for diagnostic detection. Portable single and multiplex nucleic acid-based detection is needed for crop pathogen management in agriculture. Here, we harnessed and characterized RfxCas13d as an additional CRISPR/Cas nucleic acid detection tool. We systematically characterized AsCas12a, LbCas12a, LwaCas13a, and RfxCas13d combined with isothermal amplification to develop a CRISPR/Cas nucleic acid-based tool for single or multiplex pathogen detection. Our data indicated that sufficient detection sensitivity was achieved with just a few copies of DNA/RNA targets as input. Using this tool, we successfully detected DNA from Fusarium graminearum and Fusarium verticillioides and RNA from rice black-streaked dwarf virus in crude extracts prepared in the field. Our method, from sample preparation to result readout, could be rapidly and easily deployed in the field. This system could be extended to other crop pathogens, including those that currently lack a detection method and have metabolite profiles that make detection challenging. This nucleic acid detection system could also be used for single-nucleotide polymorphism genotyping, transgene detection, and qualitative detection of gene expression in the field.
| S-EPMC8713540 | biostudies-literature
Project description:Mitigating global infectious disease requires diagnostic tools that are sensitive, specific, and rapidly field deployable. In this study, we demonstrate that the Cas13-based SHERLOCK (specific high-sensitivity enzymatic reporter unlocking) platform can detect Zika virus (ZIKV) and dengue virus (DENV) in patient samples at concentrations as low as 1 copy per microliter. We developed HUDSON (heating unextracted diagnostic samples to obliterate nucleases), a protocol that pairs with SHERLOCK for viral detection directly from bodily fluids, enabling instrument-free DENV detection directly from patient samples in <2 hours. We further demonstrate that SHERLOCK can distinguish the four DENV serotypes, as well as region-specific strains of ZIKV from the 2015-2016 pandemic. Finally, we report the rapid (<1 week) design and testing of instrument-free assays to detect clinically relevant viral single-nucleotide polymorphisms.
| S-EPMC6197056 | biostudies-literature
Project description:BACKGROUND:Surveillance of mosquito infection status is critical for planning and deployment of proper mosquito control initiatives. Point-of-care (POC) detection assays are necessary for monitoring the infection prevalence and geographical range of viruses in mosquito vector populations. We therefore assessed the novel real-time PCR (qPCR) bCUBE (Hyris, London, UK) molecular diagnostic system as a tool for virus detection. METHODS:Aedes aegypti Rps17 was used to validate and determine correlation coefficient for the novel bCUBE qPCR system to a laboratory standard StepOnePlus real-time PCR system (Applied Biosystems, Waltham, MA, USA). Experimentally infected Ae. aegypti were quantified for Zika (ZIKV) and dengue virus serotype 2 (DENV2) viral genomic RNA. Infection prevalence was compared to plaque assay. RESULTS:We developed and validated a novel qPCR system for the detection of ZIKV and DENV2 using the real-time qPCR system bCUBE. With bCUBE-based qRT-PCR, viral genomic RNA could be detected in individually infected Ae. aegypti mosquitoes and in pools of 5, 10 or 15 mosquitoes. CONCLUSIONS:The portable qPCR bCUBE diagnostic system is capable of detecting Zika and dengue virus in mosquitoes and therefore has potential as a practical field-deployable diagnostic test for vector-borne disease surveillance programmes.
| S-EPMC7513541 | biostudies-literature
Project description:Begomoviruses are a major class of Geminiviruses that affects most dicotyledonous plants and causes heavy economic losses to farmers. Early detection of begomovirus is essential to control the spread of the disease and prevent loss. Many available detection methods like ELISA, immunosorbent electron microscopy, PCR or qPCR require expertise in handling sophisticated instruments, complex data interpretation and costlier chemicals, enzymes or antibodies. Hence there is a need for a simpler detection method, here we report the development of a visual detection method based on functionalized gold nanoparticles (AuNP assay). The assay was able to detect up to 500 ag/µl of begomoviral DNA (pTZCCPp3, a clone carrying partial coat protein gene) suspended in MilliQ water. Screening of chilli plants for begomoviral infection by PCR (Deng primers) and AuNP assay showed that AuNP assay (77.7%) was better than PCR (49.4%). The AuNP assay with clccpi1 probe was able to detect begomoviral infection in chilli, tomato, common bean, green gram and black gram plants which proved the utility and versatility of the AuNP assay. The specificity of the assay was demonstrated by testing with total DNA from different plants that are not affected by begomoviruses.
| S-EPMC8271019 | biostudies-literature
Project description:The optical and biological properties of functionalized gold nanoparticles (GNPs) have been widely used in sensing applications. GNPs have a strong binding ability to thiol groups. Furthermore, thiols are used to bind functional molecules, which can then be used, for example, to detect metal ions in solution. Herein, we describe 13 nm GNPs functionalized by glutathione (GSH) and conjugated with a rhodamine 6G derivative (Rh6G2), which can be used to detect Hg(II) in cells. The detection of Hg2+ ions is based on an ion-catalyzed hydrolysis of the spirolactam ring of Rh6G2, leading to a significant change in the fluorescence of GNPs-GSH-Rh6G2 from an "OFF" to an "ON" state. This strategy is an effective tool to detect Hg2+ ions. In cytotoxicity experiments, GNPs-GSH-Rh6G2 could penetrate living cells and detect mercury ions through the fluorescent "ON" form.
| S-EPMC9235832 | biostudies-literature
Project description:Inorganic arsenic (iAs) in 13 store-bought edible seaweed samples and 34 dried kelp (Laminaria digitata) samples was determined by a newly developed, field-deployable method (FDM) with the aid of a field test kit for arsenic in water. Results from the FDM were compared to results from speciation analysis achieved by using high performance liquid chromatography coupled to inductively coupled plasma mass spectrometry (HPLC-ICP-MS). The FDM consisted of a simple extraction method using diluted HNO3 to quantitatively extract iAs without decomposing the organoarsenicals to iAs followed by the selective volatilisation of iAs as arsine (AsH3) and subsequent chemo-trapping on a filter paper soaked in mercury bromide (HgBr2) solution. Method optimization with a sub-set of samples showed 80-94% iAs recovery with the FDM with no matrix effect from organo-arsenic species in the form of dimethylarsinic acid (DMA) on the iAs concentration. The method displayed good reproducibility with an average error of ±19% and validation by HPLC-ICP-MS showed that the results from the FDM were comparable (slope = 1.03, R2 = 0.70) to those from speciation analysis with no bias. The FDM can be conducted within an hour and the observed limit of quantification was around 0.05 mg kg-1 (dry weight). This method is well suited for on-site monitoring of iAs in seaweed before it is harvested and can thus be recommended for use as a screening method for iAs in seaweed. Graphical abstractScreening seaweed for their inorganic arsenic concentration within one hour without bias has been made possible in the field by using a field deployable arsenic kit. Its accuracy and precision was compared to HPLC-ICPMS.
| S-EPMC5429896 | biostudies-literature
Project description:Rapid, sensitive, point-of-care diagnostics are critical for managing infectious diseases. Here we adapt the CRISPR-based SHERLOCK method to develop a rapid, accurate, single copy detection assay for White Spot Syndrome Virus, the most devastating virus impacting global shrimp aquaculture. Further, we combine paper matrix nucleic acid extraction and lateral flow colorimetric reporting to create a fully field-deployable, next-generation diagnostic with potential to transform veterinary pathology, disease ecology, and animal production.
| S-EPMC6928230 | biostudies-literature
Project description:Glaucoma is the leading cause of irreversible blindness worldwide and requires regular monitoring upon diagnosis to ascertain whether the disease is stable or progressing. However, making this determination remains a difficult clinical task. Recently, a novel spatiotemporal boundary detection predictor of glaucomatous visual field (VF) progression (STBound) was developed. In this work, we explore the ability of STBound to differentiate progressing and non-progressing glaucoma patients in comparison to existing methods. STBound, Spatial PROGgression, and traditional trend-based progression methods (global index (GI) regression, mean regression slope, point-wise linear regression, permutation of pointwise linear regression) were applied to longitudinal VF data from 191 eyes of 91 glaucoma patients. The ability of each method to identify progression was compared using Akaike information criterion (AIC), full/partial area under the receiver operating characteristic curve (AUC/pAUC), sensitivity, and specificity. STBound offered improved diagnostic ability (AIC: 197.77 vs. 204.11-217.55; AUC: 0.74 vs. 0.63-0.70) and showed no correlation (r: -0.01-0.11; p-values: 0.11-0.93) with the competing methods. STBound combined with GI (the top performing competitor) provided improved performance over all individual metrics and compared to all metrics combined with GI (all p-values?<?0.05). STBound may be a valuable diagnostic tool and can be used in conjunction with existing methods.
| S-EPMC6420602 | biostudies-literature
Project description:Gold nanoparticles functionalized with resorcinol moieties have been prepared and used for detecting formaldehyde both in solution and gas phases. The detection mechanism is based on the color change of the probe upon the aggregation of the nanoparticles induced by the polymerization of the resorcinol moieties in the presence of formaldehyde. A limit of detection of 0.5 ppm in solution has been determined. The probe can be deployed for the detection of formaldehyde emissions from composite wood boards.
| S-EPMC6409679 | biostudies-literature