Dataset Information

Association between -238 but not -308 polymorphism of Tumor necrosis factor alpha (TNF-alpha)v and unexplained recurrent spontaneous abortion (URSA) in Chinese population.

ABSTRACT:

Objectives

TNF-alpha is a critical cytokine produced by Th1 cells while altered T helper 1 (Th1)-Th2 balance is found crucial for a successful pregnancy.

Study design

A cohort of 132 Southern Chinese Han RSA patients and 152 controls constituted the subjects of this study. Two functional polymorphisms -308 and -238 of TNF-alpha were studied by association analysis.

Results

lack of association was found in TNF-alpha -308 SNP yet a significant difference was discovered in -238 polymorphism.

Conclusion

This study suggested that TNF-alpha may be a risk factor in Chinese RSA patients. However the ethnic differences may also contribute to the results.

SUBMITTER: Liu C

PROVIDER: S-EPMC2956720 | biostudies-literature | 2010 Sep

REPOSITORIES: biostudies-literature

ACCESS DATA

Publications

Association between -238 but not -308 polymorphism of Tumor necrosis factor alpha (TNF-alpha)v and unexplained recurrent spontaneous abortion (URSA) in Chinese population.

Liu Chunmei C Wang Jing J Zhou Sirui S Wang Binbin B Ma Xu X

Reproductive biology and endocrinology : RB&E 20100928

<h4>Objectives</h4>TNF-alpha is a critical cytokine produced by Th1 cells while altered T helper 1 (Th1)-Th2 balance is found crucial for a successful pregnancy.<h4>Study design</h4>A cohort of 132 Southern Chinese Han RSA patients and 152 controls constituted the subjects of this study. Two functional polymorphisms -308 and -238 of TNF-alpha were studied by association analysis.<h4>Results</h4>lack of association was found in TNF-alpha -308 SNP yet a significant difference was discovered in -23 ...[more]

PMID: 20920206

Similar Datasets

Project description:Individual studies have assessed the association between TNF-α-308G>A and TNF-α-238 G>A polymorphisms and severity of dengue infection. However, the results are inconclusive and most studies had small sample sizes. The objective of this study was to summarize the evidence of association between TNF-α-308 G>A and TNF-α-238 G>A and severity of dengue infection. This study follows the preferred reporting items for systematic reviews and meta- analyses of genetic association studies, recommended by PLOS One. We calculated pooled odds ratio and its 95% confidence interval (CI) to estimate the association between TNF-α-308 G>A or TNF-α-238 G>A and the risk of severe dengue infections. To determine the information size required for this meta-analysis study, a trial sequential analysis (TSA) was done. Eight studies (640 cases and 1275 controls), which assessed the association of TNF-α-308 G>A or TNF-α-238 G>A and the risk of DHF were included. Overall, we found no significant association between TNF-α-308 G>A and the DHF risk in the allelic model (OR, 0.91; 95% CI, 0.51-1.63), the recessive model (OR,1.32;95%CI,0.73-2.37), the dominant model (OR,0.93;95%CI:0.59-1.47) or the additive model (OR,1.43,95;95%CI:0.79-2.59). There was also no significant association between TNF-α-238 G>A and DHF risk under the allele contrast model (OR:1.51;95%CI:0.88-2.58), the recessive model (OR,1.48,95% CI:0.33-6.58), the dominant model (OR,1.48;95%CI:0.56-3.92), or the additive model (OR:1.5;95%CI:0.34-6.69). On subgroup analysis, neither the Asian population nor the non-Asian population showed significant association between TNF-α-308 G>A/TNF-α-238 G>A and the DHF risk under any genetic models. Leave-one-out meta-analysis showed stability of the results. TSA plots suggested that the sample size in this meta-analysis study was below the required information size. The findings suggest an inclusive evidence of the association between TNF-α-308/ TNF-α-238 G>A and the risk of developing severe dengue infection. Large studies with evidence of Hardy-Weinberg equilibrium, assessing gene-gene interactions are recommended.

Project description:BackgroundThe precise etiology of approximately 50% of patients with recurrent spontaneous abortion (RSA) is unclear, known as unexplained recurrent spontaneous abortion (URSA). This study identified the genetic polymorphisms in patients with URSA.MethodsGenomic DNA was extracted from 30 couples with URSA and 9 couples with normal reproductive history for whole exome sequencing. Variations in annotation, filtering, and prediction of harmfulness and pathogenicity were examined. Furthermore, predictions of the effects of changes in protein structure, Sanger validation, and functional enrichment analyses were performed. The missense mutated genes with significant changes in protein function, and genes with mutations of premature stop, splice site, frameshift, and in-frame indel were selected as candidate mutated genes related to URSA.ResultsIn 30 unrelated couples with URSA, 50%, 20%, and 30% had 2, 3, and more than 4 miscarriages, respectively. Totally, 971 maternal and 954 paternal mutations were found to be pathogenic or possibly pathogenic after preliminary filtering. Total variations were not associated with age nor the number of miscarriages. In 28 patients (involving 23 couples), 22 pathogenic or possibly pathogenic variants of 19 genes were found to be strongly associated with URSA, with an abnormality rate of 76.67%. Among these, 12 missense variants showed obvious changes in protein functions, including ANXA5 (c.949G>C; p.G317R), APP (c.1530G>C; p.K510N), DNMT1 (c.2626G>A; p.G876R), FN1 (c.5621T>C; p.M1874T), MSH2 (c.1168G>A; p.L390F), THBS1 (c.2099A>G; p.N700S), KDR (c.2440G>A; p.D814N), POLR2B (c.406G>T; p.G136C), ITGB1 (c.655T>C; p.Y219H), PLK1 (c.1210G>T; p.A404S), COL4A2 (c.4808 A>C; p.H1603P), and LAMA4 (c.3158A>G; p.D1053G). Six other genes with mutations of premature stop, splice site, frameshift, and in-frame indel were also identified, including BUB1B (c.1648C>T; p.R550*) and MMP2 (c.1462_1464delTTC; p.F488del) from the father, and mutations from mother and/or father including BPTF (c.396_398delGGA; p.E138 del and c.429_431GGA; p.E148del), MECP2 (c.21_23delCGC; p.A7del), LAMA2 (HGVS: NA; Exon: NA; SPLICE_SITE, DONOR), and SOX21 (c.640 _641insT; p. A214fs, c.644dupC; p. A215fs and c.644_645ins ACGCGTCTTCTTCCCGCAGTC; p. A215dup).ConclusionsThese pathogenic or potentially pathogenic mutated genes may be potential biomarkers for URSA and may play an auxiliary role in the treatment of URSA.

Project description:BackgroundUnexplained recurrent spontaneous abortion (URSA) is one of the most challenging conditions frustrates women of childbearing age profoundly. The gene expression patterns and biological characteristics of placental villus in patients with URSA remain largely unknown. The aim of our study was to identify potential lncRNAs as well as their action mechanisms in URSA.MethodThe ceRNA microarray was used to identify the mRNA and lncRNA expression profiles of URSA patients and normal pregnancy. Functional enrichment analyses for differentially expressed mRNAs in URSA were performed. Protein-protein interaction analysis of differentially expressed mRNAs was performed to identify hub genes and key modules. Subsequently, the co-dysregulated ceRNA network of URSA was established, and the enrichment analyses for the mRNAs in the ceRNA network was implemented. qRT-PCR was performed to validated the expression of key ENST00000429019 and mRNAs in URSA.ResultsWe found that URSA placental villus have distinct mRNA and lncRNA expression profiles through ceRNA microarray, with a total of 347 mRNAs and 361 lncRNAs differentially expressed compared with controls. The functional enrichment analysis revealed that ncRNA processing, DNA replication, cell cycle, apoptosis, cytokine-mediated signaling pathway, ECM-receptor interaction were the potentially disrupted pathways in URSA patients. Then we constructed a co-dysregulated ceRNA network and found differentially expressed mRNAs were regulated by a small fraction of hub lncRNAs. Finally, we found a key network of ENST00000429019 and three cell proliferation or apoptosis related key mRNAs (CDCA3, KIFC1, NCAPH), and validated their expression and regulation in tissue and cellular levels.ConclusionsThis study identified a key ceRNA network, which might take part in URSA and correlate with cell proliferation and apoptosis. Optimistically, this study may deepen our apprehensions about the underlying molecular and biological causes of URSA and provide an important theoretical basis for future therapeutic strategies for patients with URSA.

Dataset Information

Association between -238 but not -308 polymorphism of Tumor necrosis factor alpha (TNF-alpha)v and unexplained recurrent spontaneous abortion (URSA) in Chinese population.

Objectives

Study design

Results

Conclusion

Publications

Association between -238 but not -308 polymorphism of Tumor necrosis factor alpha (TNF-alpha)v and unexplained recurrent spontaneous abortion (URSA) in Chinese population.

Similar Datasets

OmicsDI is part of the ELIXIR infrastructure

Tweets