Dataset Information

Differences in Cytokine Expression and STAT3 Activation between Healthy Controls and Patients of Unexplained Recurrent Spontaneous Abortion (URSA) during Early Pregnancy.

ABSTRACT: Unexplained recurrent spontaneous abortion (URSA) is a common complication of pregnancy. Although tolerance of the maternal immune system is considered to be essential for a normal pregnancy, the precise mechanism underlying the pathogenesis of URSA remains to be fully elucidated, albeit it is known to involve inflammation. Here, we examine the relationship between the expression of inflammatory cytokines and the activation of downstream signaling pathways in URSA patients. Decidual and peripheral blood samples were collected from 30 URSA patients and from 30 women with normal early pregnancies. Western blot analysis was used to measure the expression levels of signal transducers and activators of transcription 3(STAT3), phosphorylated STAT3(p-STAT3), and interleukin-17 receptor(IL-17R) in the decidual samples. Enzyme-linked immunosorbent assay was used to assess the levels of IL-17, IL-10, IL-6, and IL-23 in the peripheral blood and decidual samples. In the URSA patients, the IL-10 expression levels were lower than those in the control subjects (P<0.05), whereas IL-6, IL-17, and IL-23 were all expressed at higher levels(P<0.05). Furthermore, the expression levels of IL-17R and p-STAT3 were higher in the URSA patients, exhibiting a trend similar to that of IL-23. Our finding of increased IL-23 expression in the deciduae and peripheral blood of patients with URSA suggest that this maybe a contributing factor to the pathogenesis of this disease. Likewise, STAT3 activation through its phosphorylation, which was associated with the IL-23 increase, may also be involved in URSA pathogenesis. However, the precise pathogenic mechanism requires further study.

SUBMITTER: Cai J

PROVIDER: S-EPMC5033573 | biostudies-literature | 2016

REPOSITORIES: biostudies-literature

ACCESS DATA

Publications

Differences in Cytokine Expression and STAT3 Activation between Healthy Controls and Patients of Unexplained Recurrent Spontaneous Abortion (URSA) during Early Pregnancy.

Cai JunYing J Li MuJun M Huang QianYi Q Fu XiaoQian X Wu HuiMei H

PloS one 20160922 9

Unexplained recurrent spontaneous abortion (URSA) is a common complication of pregnancy. Although tolerance of the maternal immune system is considered to be essential for a normal pregnancy, the precise mechanism underlying the pathogenesis of URSA remains to be fully elucidated, albeit it is known to involve inflammation. Here, we examine the relationship between the expression of inflammatory cytokines and the activation of downstream signaling pathways in URSA patients. Decidual and peripher ...[more]

PMID: 27657728

Similar Datasets

Project description:BackgroundThe precise etiology of approximately 50% of patients with recurrent spontaneous abortion (RSA) is unclear, known as unexplained recurrent spontaneous abortion (URSA). This study identified the genetic polymorphisms in patients with URSA.MethodsGenomic DNA was extracted from 30 couples with URSA and 9 couples with normal reproductive history for whole exome sequencing. Variations in annotation, filtering, and prediction of harmfulness and pathogenicity were examined. Furthermore, predictions of the effects of changes in protein structure, Sanger validation, and functional enrichment analyses were performed. The missense mutated genes with significant changes in protein function, and genes with mutations of premature stop, splice site, frameshift, and in-frame indel were selected as candidate mutated genes related to URSA.ResultsIn 30 unrelated couples with URSA, 50%, 20%, and 30% had 2, 3, and more than 4 miscarriages, respectively. Totally, 971 maternal and 954 paternal mutations were found to be pathogenic or possibly pathogenic after preliminary filtering. Total variations were not associated with age nor the number of miscarriages. In 28 patients (involving 23 couples), 22 pathogenic or possibly pathogenic variants of 19 genes were found to be strongly associated with URSA, with an abnormality rate of 76.67%. Among these, 12 missense variants showed obvious changes in protein functions, including ANXA5 (c.949G>C; p.G317R), APP (c.1530G>C; p.K510N), DNMT1 (c.2626G>A; p.G876R), FN1 (c.5621T>C; p.M1874T), MSH2 (c.1168G>A; p.L390F), THBS1 (c.2099A>G; p.N700S), KDR (c.2440G>A; p.D814N), POLR2B (c.406G>T; p.G136C), ITGB1 (c.655T>C; p.Y219H), PLK1 (c.1210G>T; p.A404S), COL4A2 (c.4808 A>C; p.H1603P), and LAMA4 (c.3158A>G; p.D1053G). Six other genes with mutations of premature stop, splice site, frameshift, and in-frame indel were also identified, including BUB1B (c.1648C>T; p.R550*) and MMP2 (c.1462_1464delTTC; p.F488del) from the father, and mutations from mother and/or father including BPTF (c.396_398delGGA; p.E138 del and c.429_431GGA; p.E148del), MECP2 (c.21_23delCGC; p.A7del), LAMA2 (HGVS: NA; Exon: NA; SPLICE_SITE, DONOR), and SOX21 (c.640 _641insT; p. A214fs, c.644dupC; p. A215fs and c.644_645ins ACGCGTCTTCTTCCCGCAGTC; p. A215dup).ConclusionsThese pathogenic or potentially pathogenic mutated genes may be potential biomarkers for URSA and may play an auxiliary role in the treatment of URSA.

Project description:BackgroundUnexplained recurrent spontaneous abortion (URSA) is one of the most challenging conditions frustrates women of childbearing age profoundly. The gene expression patterns and biological characteristics of placental villus in patients with URSA remain largely unknown. The aim of our study was to identify potential lncRNAs as well as their action mechanisms in URSA.MethodThe ceRNA microarray was used to identify the mRNA and lncRNA expression profiles of URSA patients and normal pregnancy. Functional enrichment analyses for differentially expressed mRNAs in URSA were performed. Protein-protein interaction analysis of differentially expressed mRNAs was performed to identify hub genes and key modules. Subsequently, the co-dysregulated ceRNA network of URSA was established, and the enrichment analyses for the mRNAs in the ceRNA network was implemented. qRT-PCR was performed to validated the expression of key ENST00000429019 and mRNAs in URSA.ResultsWe found that URSA placental villus have distinct mRNA and lncRNA expression profiles through ceRNA microarray, with a total of 347 mRNAs and 361 lncRNAs differentially expressed compared with controls. The functional enrichment analysis revealed that ncRNA processing, DNA replication, cell cycle, apoptosis, cytokine-mediated signaling pathway, ECM-receptor interaction were the potentially disrupted pathways in URSA patients. Then we constructed a co-dysregulated ceRNA network and found differentially expressed mRNAs were regulated by a small fraction of hub lncRNAs. Finally, we found a key network of ENST00000429019 and three cell proliferation or apoptosis related key mRNAs (CDCA3, KIFC1, NCAPH), and validated their expression and regulation in tissue and cellular levels.ConclusionsThis study identified a key ceRNA network, which might take part in URSA and correlate with cell proliferation and apoptosis. Optimistically, this study may deepen our apprehensions about the underlying molecular and biological causes of URSA and provide an important theoretical basis for future therapeutic strategies for patients with URSA.

Dataset Information

Differences in Cytokine Expression and STAT3 Activation between Healthy Controls and Patients of Unexplained Recurrent Spontaneous Abortion (URSA) during Early Pregnancy.

Publications

Differences in Cytokine Expression and STAT3 Activation between Healthy Controls and Patients of Unexplained Recurrent Spontaneous Abortion (URSA) during Early Pregnancy.

Similar Datasets

OmicsDI is part of the ELIXIR infrastructure

Tweets