Dataset Information

Tumor necrosis factor-? gene polymorphisms in Korean patients with recurrent spontaneous abortion.

ABSTRACT: The objective of this study was to investigate the contribution of the tumor necrosis factor-? (TNF-?) gene polymorphisms to recurrent spontaneous abortion (RSA). The study participants consisted of 357 Korean women with RSA and 236 fertile women controls. Four TNF-? gene variants of all participants were analyzed by polymerase chain reaction-restriction fragment length polymorphism assay. The TNF-? -1031T>C and TNF-? -238G>A variants increased the risk of RSA TNF-? -1031TC+CC; adjusted odds ratio [AOR], 2.292; 95% confidence interval [CI], 1.547-3.395; P < .001; TNF-? -238GA+AA; AOR, 2.327; 95% CI, 1.038-5.217; P = .040), and these data were not different in a stratified analysis according to the number of consecutive spontaneous abortions. Also, the mutant genotypes of TNF-? -1031 and TNF-? -238 showed synergistic effects on increased RSA risk (-1031TC+CC/-238GA+AA; AOR, 4.054; 95% CI, 1.520-10.812; P = .005). In haplotype analysis, there were similar trends of data for combination analysis. In conclusion, the TNF-? -1031T>C and TNF-? -238G>A variants are possible genetic risk factors for RSA.

SUBMITTER: Lee BE

PROVIDER: S-EPMC4077515 | biostudies-literature | 2013 Apr

REPOSITORIES: biostudies-literature

ACCESS DATA

Publications

Tumor necrosis factor-α gene polymorphisms in Korean patients with recurrent spontaneous abortion.

Lee Bo Eun BE Jeon Young Joo YJ Shin Ji Eun JE Kim Ji Hyang JH Choi Dong Hee DH Jung Yong Wook YW Shim Sung Han SH Lee Woo Sik WS Kim Nam Keun NK

Reproductive sciences (Thousand Oaks, Calif.) 20121129 4

The objective of this study was to investigate the contribution of the tumor necrosis factor-α (TNF-α) gene polymorphisms to recurrent spontaneous abortion (RSA). The study participants consisted of 357 Korean women with RSA and 236 fertile women controls. Four TNF-α gene variants of all participants were analyzed by polymerase chain reaction-restriction fragment length polymorphism assay. The TNF-α -1031T>C and TNF-α -238G>A variants increased the risk of RSA TNF-α -1031TC+CC; adjusted odds rat ...[more]

PMID: 23202728

Similar Datasets

Project description:BackgroundThe precise etiology of approximately 50% of patients with recurrent spontaneous abortion (RSA) is unclear, known as unexplained recurrent spontaneous abortion (URSA). This study identified the genetic polymorphisms in patients with URSA.MethodsGenomic DNA was extracted from 30 couples with URSA and 9 couples with normal reproductive history for whole exome sequencing. Variations in annotation, filtering, and prediction of harmfulness and pathogenicity were examined. Furthermore, predictions of the effects of changes in protein structure, Sanger validation, and functional enrichment analyses were performed. The missense mutated genes with significant changes in protein function, and genes with mutations of premature stop, splice site, frameshift, and in-frame indel were selected as candidate mutated genes related to URSA.ResultsIn 30 unrelated couples with URSA, 50%, 20%, and 30% had 2, 3, and more than 4 miscarriages, respectively. Totally, 971 maternal and 954 paternal mutations were found to be pathogenic or possibly pathogenic after preliminary filtering. Total variations were not associated with age nor the number of miscarriages. In 28 patients (involving 23 couples), 22 pathogenic or possibly pathogenic variants of 19 genes were found to be strongly associated with URSA, with an abnormality rate of 76.67%. Among these, 12 missense variants showed obvious changes in protein functions, including ANXA5 (c.949G>C; p.G317R), APP (c.1530G>C; p.K510N), DNMT1 (c.2626G>A; p.G876R), FN1 (c.5621T>C; p.M1874T), MSH2 (c.1168G>A; p.L390F), THBS1 (c.2099A>G; p.N700S), KDR (c.2440G>A; p.D814N), POLR2B (c.406G>T; p.G136C), ITGB1 (c.655T>C; p.Y219H), PLK1 (c.1210G>T; p.A404S), COL4A2 (c.4808 A>C; p.H1603P), and LAMA4 (c.3158A>G; p.D1053G). Six other genes with mutations of premature stop, splice site, frameshift, and in-frame indel were also identified, including BUB1B (c.1648C>T; p.R550*) and MMP2 (c.1462_1464delTTC; p.F488del) from the father, and mutations from mother and/or father including BPTF (c.396_398delGGA; p.E138 del and c.429_431GGA; p.E148del), MECP2 (c.21_23delCGC; p.A7del), LAMA2 (HGVS: NA; Exon: NA; SPLICE_SITE, DONOR), and SOX21 (c.640 _641insT; p. A214fs, c.644dupC; p. A215fs and c.644_645ins ACGCGTCTTCTTCCCGCAGTC; p. A215dup).ConclusionsThese pathogenic or potentially pathogenic mutated genes may be potential biomarkers for URSA and may play an auxiliary role in the treatment of URSA.

Dataset Information

Tumor necrosis factor-? gene polymorphisms in Korean patients with recurrent spontaneous abortion.

Publications

Tumor necrosis factor-α gene polymorphisms in Korean patients with recurrent spontaneous abortion.

Similar Datasets

OmicsDI is part of the ELIXIR infrastructure

Tweets