Browse
Submit Data
Databases
API
Help

Dataset Information

0 Views

0 Connections

0 Citations

0 Reanalyses

0 Downloads

Omics score: 0

Transcriptional analysis of the effect of exogenous decanoic acid stress on Streptomyces roseosporus.

ABSTRACT:

Background

Daptomycin is an important antibiotic against infections caused by drug-resistant pathogens. Its production critically depends on the addition of decanoic acid during fermentation. Unfortunately, decanoic acid (>2.5 mM) is toxic to daptomycin producer, Streptomyces roseosporus.

Results

To understand the mechanism underlying decanoic tolerance or toxicity, the responses of S. roseosporus was determined by a combination of phospholipid fatty acid analysis, reactive oxygen species (ROS) measurement and RNA sequencing. Assays using fluorescent dyes indicated a sharp increase in reactive oxygen species during decanoic acid stress; fatty acid analysis revealed a marked increase in the composition of branched-chain fatty acids by approximately 10%, with a corresponding decrease in straight-chain fatty acids; functional analysis indicated decanoic acid stress has components common to other stress response, including perturbation of respiratory functions (nuo and cyd operons), oxidative stress, and heat shock. Interestingly, our transcriptomic analysis revealed that genes coding for components of proteasome and related to treholase synthesis were up-regulated in the decanoic acid -treated cells.

Conclusion

These findings represent an important first step in understanding mechanism of decanoic acid toxicity and provide a basis for engineering microbial tolerance.

SUBMITTER: Liao G

PROVIDER: S-EPMC3724488 | biostudies-literature | 2013 Feb

REPOSITORIES: biostudies-literature

ACCESS DATA

Json Xml

Similar Datasets

Molecular mechanism of mureidomycin biosynthesis activated by introduction of an exogenous regulatory gene ssaA into Streptomyces roseosporus.

Project description:Mureidomycins (MRDs), a group of unique uridyl-peptide antibiotics, exhibit antibacterial activity against the highly refractory pathogen Pseudomonas aeruginosa. Our previous study showed that the cryptic MRD biosynthetic gene cluster (BGC) mrd in Streptomyces roseosporus NRRL 15998 could not be activated by its endogenous regulator 02995 but activated by an exogenous activator SsaA from sansanmycin's BGC ssa of Streptomyces sp. strain SS. Here we report the molecular mechanism for this inexplicable regulation. EMSAs and footprinting experiments revealed that SsaA could directly bind to a 14-nt palindrome sequence of 5'-CTGRCNNNNGTCAG-3' within six promoter regions of mrd. Disruption of three representative target genes (SSGG-02981, SSGG-02987 and SSGG-02994) showed that the target genes directly controlled by SsaA were essential for MRD production. The regulatory function was further investigated by replacing six regions of SSGG-02995 with those of ssaA. Surprisingly, only the replacement of 343-450 nt fragment encoding the 115-150 amino acids (AA) of SsaA could activate MRD biosynthesis. Further bioinformatics analysis showed that the 115-150 AA situated between two conserved domains of SsaA. Our findings significantly demonstrate that constitutive expression of a homologous exogenous regulatory gene is an effective strategy to awaken cryptic biosynthetic pathways in Streptomyces.

| S-EPMC7880210 | biostudies-literature

Transcriptional regulation of the daptomycin gene cluster in Streptomyces roseosporus by an autoregulator, AtrA.

Project description:Daptomycin is a cyclic lipopeptide antibiotic produced by Streptomyces roseosporus. To reveal the transcriptional regulatory mechanism of daptomycin biosynthesis, we used the biotinylated dptE promoter (dptEp) as a probe to affinity isolate the dptEp-interactive protein AtrA, a TetR family transcriptional regulator, from the proteome of mycelia. AtrA bound directly to dptEp to positively regulate gene cluster expression and daptomycin production. Meanwhile, both ΔatrA and ΔadpA mutants showed bald phenotype and null production of daptomycin. AdpA positively regulated atrA expression by direct interaction with atrA promoter (atrAp), and removal of ArpA in S. roseosporus, a homolog of the A-factor receptor, resulted in accelerated morphological development and increased daptomycin production, suggesting that atrA was the target of AdpA to mediate the A-factor signaling pathway. Furthermore, AtrA was positively autoregulated by binding to its own promoter atrAp. Thus, for the first time at the transcriptional level, we have identified an autoregulator, AtrA, that directly mediates the A-factor signaling pathway to regulate the proper production of daptomycin.

| S-EPMC4367297 | biostudies-literature

A MarR Family Transcriptional Regulator, DptR3, Activates Daptomycin Biosynthesis and Morphological Differentiation in Streptomyces roseosporus.

Project description:Daptomycin produced by Streptomyces roseosporus is an important lipopeptide antibiotic used to treat human infections caused by Gram-positive pathogenic bacteria, including drug-resistant strains. The genetic basis for regulatory mechanisms of daptomycin production is poorly known. Here, we characterized the dptR3 gene, which encodes a MarR family transcriptional regulator located adjacent to the known daptomycin biosynthetic (dpt) genes. Deletion of dptR3 reduced daptomycin production significantly and delayed aerial mycelium formation and sporulation on solid media. Dissection of the mechanism underlying the function of DptR3 in daptomycin production revealed that it stimulates daptomycin production indirectly by altering the transcription of dpt structural genes. DptR3 directly activated the transcription of its own gene, dptR3, but repressed the transcription of the adjacent, divergent gene orf16 (which encodes a putative ABC transporter ATP-binding protein). A 66-nucleotide DptR3-binding site in the intergenic region of dptR3-orf16 was determined by DNase I footprinting, and the palindromic sequence TCATTGTTACCTATGCTCACAATGA (underlining indicates inverted repeats) in the protected region was found to be essential for DptR3 binding. orf16, the major target gene of DptR3, exerted a positive effect on daptomycin biosynthesis. Our findings indicate that DptR3 functions as a global regulator that positively controls daptomycin production and morphological development in S. roseosporus.

| S-EPMC4421045 | biostudies-literature

DepR1, a TetR Family Transcriptional Regulator, Positively Regulates Daptomycin Production in an Industrial Producer, Streptomyces roseosporus SW0702.

Project description:Daptomycin is a potent cyclic lipopeptide antibiotic. It is widely used against various Gram-positive bacterial pathogens. Historically, a poor understanding of the transcriptional regulation of daptomycin biosynthesis has limited the options for targeted genetic engineering toward titer improvement. Here, we isolated a TetR family transcriptional regulator, DepR1, from the industrial producer Streptomyces roseosporus SW0702 using a biotinylated dptE promoter (dptEp) as a probe. The direct interaction between DepR1 and dptEp then was confirmed by electrophoretic mobility shift assays and DNase I footprinting assays. The deletion of depR1 led to a reduction in dptEp activity and the cessation of daptomycin production. The ΔdepR1 mutant produced less red pigment and failed to sporulate on R5 medium. This suggests that DepR1 plays a positive role in the control of morphological differentiation. Moreover, DepR1 was positively autoregulated by directly binding to its own promoter. This might account for the positive feedback regulation of daptomycin production. Based on these positive effects, genetic engineering by overexpression of depR1 raised daptomycin production and shortened the fermentation period both in flask and in fermentor.

| S-EPMC4784024 | biostudies-literature

Transcriptional Regulator DasR Represses Daptomycin Production through Both Direct and Cascade Mechanisms in <i>Streptomyces roseosporus</i>.

Project description:Daptomycin, produced by Streptomyces roseosporus, is a clinically important cyclic lipopeptide antibiotic used for the treatment of human infections caused by drug-resistant Gram-positive pathogens. In contrast to most Streptomyces antibiotic biosynthetic gene clusters (BGCs), daptomycin BGC has no cluster-situated regulator (CSR) genes. DasR, a GntR-family transcriptional regulator (TR) widely present in the genus, was shown to regulate antibiotic production in model species S. coelicolor by binding to promoter regions of CSR genes. New findings reported here reveal that DasR pleiotropically regulates production of daptomycin and reddish pigment, and morphological development in S. roseosporus. dasR deletion enhanced daptomycin production and morphological development, but reduced pigment production. DasR inhibited daptomycin production by directly repressing dpt structural genes and global regulatory gene adpA (whose product AdpA protein activates daptomycin production and morphological development). DasR-protected regions on dptEp and adpAp contained a 16 nt sequence similar to the consensus DasR-binding site dre in S. coelicolor. AdpA was shown to target dpt structural genes and dptR2 (which encodes a DeoR-family TR required for daptomycin production). A 10 nt sequence similar to the consensus AdpA-binding site was found on target promoter regions dptAp and dptR2p. This is the first demonstration that DasR regulates antibiotic production both directly and through a cascade mechanism. The findings expand our limited knowledge of the regulatory network underlying daptomycin production, and will facilitate methods for construction of daptomycin overproducers.

| S-EPMC9404778 | biostudies-literature

Effect of decanoic acid and 10-hydroxydecanoic acid on the biotransformation of methyl decanoate to sebacic acid.

Project description:Biotransformation of fatty acid methyl esters to dicarboxylic acids has attracted much attention in recent years; however, reports of sebacic acid production using such biotransformation remain few. The toxicity of decanoic acid is the main challenge for this process. Decane induction has been reported to be essential to activate the enzymes involved in the ?,?-oxidation pathway before initiating the biotransformation of methyl decanoate to sebacic acid. However, we observed the accumulation of intermediates (decanoic acid and 10-hydroxydecanoic acid) during the induction period. In this study, we examined the effects of these intermediates on the biotransformation process. The presence of decanoic acid, even at a low concentration (0.2 g/L), inhibited the transformation of 10-hydroxydecanoic acid to sebacic acid. Moreover, about 24-32% reduction in the decanoic acid oxidation was observed in the presence of 0.5-1.5 g/L 10-hydroxydecanoic acid. To eliminate these inhibitory effects, we applied substrate-limiting conditions during the decane induction process, which eliminated the accumulation of decanoic acid. Although the productivity of sebacic acid (34.5?±?1.10 g/L) was improved, by 28% over that achieved using the previously methods, after 54 h, the accumulation of 10-hydroxydecanoic acid was still detected. The accumulation of 10-hydroxydecanoic acid even under the decane limiting conditions could be an evidence that oxidation of 10-hydroxydecanoic acid could be the rate-limiting step in this process. The improvement of this reaction should be an important objective for further development of the production of sebacic acid using biotransformation.

| S-EPMC5936482 | biostudies-literature

Comparative Transcriptome Analysis Demonstrates the Positive Effect of the Cyclic AMP Receptor Protein Crp on Daptomycin Biosynthesis in <i>Streptomyces roseosporus</i>.

Project description:Daptomycin, which is produced by Streptomyces roseosporus, has been characterized as a novel cyclic lipopeptide antibiotic that is effective against Gram-positive bacteria. The biosynthesis of daptomycin is regulated by various factors. In the present study, we demonstrated that the cyclic AMP receptor protein (Crp) plays an important role in producing daptomycin in the S. roseosporus industrial strain. We found that daptomycin production from the crp deletion strain decreased drastically, whereas production from the crp overexpression strain increased by 22.1%. Transcriptome and qPCR analyses showed that some genes related to the daptomycin biosynthetic gene cluster (dpt) and the pleiotropic regulator (adpA) were significantly upregulated. RNA-seq also shows Crp to be a multifunctional regulator that modulates primary metabolism and enhances precursor flux to secondary metabolite biosynthesis. These results provide guidance for the development and improvement of potential natural products.

| S-EPMC8212052 | biostudies-literature

Decanoic Acid Stimulates Autophagy in D. discoideum.

Project description:Ketogenic diets, used in epilepsy treatment, are considered to work through reduced glucose and ketone generation to regulate a range of cellular process including autophagy induction. Recent studies into the medium-chain triglyceride (MCT) ketogenic diet have suggested that medium-chain fatty acids (MCFAs) provided in the diet, decanoic acid and octanoic acid, cause specific therapeutic effects independent of glucose reduction, although a role in autophagy has not been investigated. Both autophagy and MCFAs have been widely studied in Dictyostelium, with findings providing important advances in the study of autophagy-related pathologies such as neurodegenerative diseases. Here, we utilize this model to analyze a role for MCFAs in regulating autophagy. We show that treatment with decanoic acid but not octanoic acid induces autophagosome formation and modulates autophagic flux in high glucose conditions. To investigate this effect, decanoic acid, but not octanoic acid, was found to induce the expression of autophagy-inducing proteins (Atg1 and Atg8), providing a mechanism for this effect. Finally, we demonstrate a range of related fatty acid derivatives with seizure control activity, 4BCCA, 4EOA, and Epilim (valproic acid), also function to induce autophagosome formation in this model. Thus, our data suggest that decanoic acid and related compounds may provide a less-restrictive therapeutic approach to activate autophagy.

| S-EPMC8616062 | biostudies-literature

Crotonylation of key metabolic enzymes regulates carbon catabolite repression in Streptomyces roseosporus.

Project description:Due to the plethora natural products made by Streptomyces, the regulation of its metabolism are of great interest, whereas there is a lack of detailed understanding of the role of posttranslational modifications (PTM) beyond traditional transcriptional regulation. Herein with Streptomyces roseosporus as a model, we showed that crotonylation is widespread on key enzymes for various metabolic pathways, and sufficient crotonylation in primary metabolism and timely elimination in secondary metabolism are required for proper Streptomyces metabolism. Particularly, the glucose kinase Glk, a keyplayer of carbon catabolite repression (CCR) regulating bacterial metabolism, is identified reversibly crotonylated by the decrotonylase CobB and the crotonyl-transferase Kct1 to negatively control its activity. Furthermore, crotonylation positively regulates CCR for Streptomyces metabolism through modulation of the ratio of glucose uptake/Glk activity and utilization of carbon sources. Thus, our results revealed a regulatory mechanism that crotonylation globally regulates Streptomyces metabolism at least through positive modulation of CCR.

| S-EPMC7181814 | biostudies-literature

Identification and Characterization of a New Regulator, TagR, for Environmental Stress Resistance Based on the DNA Methylome of Streptomyces roseosporus.

Project description:DNA methylation is a defense that microorganisms use against extreme environmental stress, and improving resistance against environmental stress is essential for industrial actinomycetes. However, research on strain optimization utilizing DNA methylation for breakthroughs is rare. Based on DNA methylome analysis and KEGG pathway assignment in Streptomyces roseosporus, we discovered an environmental stress resistance regulator, TagR. A series of in vivo and in vitro experiments identified TagR as a negative regulator, and it is the first reported regulator of the wall teichoic acid (WTA) ABC transport system. Further study showed that TagR had a positive self-regulatory loop and m4C methylation in the promoter improved its expression. The ΔtagR mutant exhibited better hyperosmotic resistance and higher decanoic acid tolerance than the wild type, which led to a 100% increase in the yield of daptomycin. Moreover, enhancing the expression of the WTA transporter resulted in better osmotic stress resistance in Streptomyces lividans TK24, indicating the potential for wide application of the TagR-WTA transporter regulatory pathway. This research confirmed the feasibility and effectiveness of mining regulators of environmental stress resistance based on the DNA methylome, characterized the mechanism of TagR, and improved the resistance and daptomycin yield of strains. Furthermore, this research provides a new perspective on the optimization of industrial actinomycetes. IMPORTANCE This study established a novel strategy for screening regulators of environmental stress resistance based on the DNA methylome and discovered a new regulator, TagR. The TagR-WTA transporter regulatory pathway improved the resistance and antibiotic yield of strains and has the potential for wide application. Our research provides a new perspective on the optimization and reconstruction of industrial actinomycetes.

| S-EPMC10269677 | biostudies-literature

OmicsDI is part of the ELIXIR infrastructure

OmicsDI is an Elixir interoperability service. Learn more ›

Tweets

OmicsDI Databases

PRIDE
PeptideAtlas
MassIVE
JPOST Repository
Physiome Model Repository

EGA
EVA
ENA
LINCS
PAXDB
Cell Collective

MetaboLights
Metabolomics Workbench
MetabolomeExpress
GNPS
BioModels
FAIRDOMHub

ArrayExpress
dbGaP
ExpressionAtlas
GEO
NODE

Information

Databases
Help
API
Contact us
Code on GitHub
Terms of use
Submit Data